Incidental Mutation 'R7928:Zfp950'
ID643443
Institutional Source Beutler Lab
Gene Symbol Zfp950
Ensembl Gene ENSMUSG00000074733
Gene Namezinc finger protein 950
SynonymsBC029127
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7928 (G1)
Quality Score999
Status Validated
Chromosome19
Chromosomal Location61053840-61140840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 61119500 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 382 (P382T)
Ref Sequence ENSEMBL: ENSMUSP00000146243 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000122927
Predicted Effect probably benign
Transcript: ENSMUST00000127117
Predicted Effect probably benign
Transcript: ENSMUST00000127290
Predicted Effect probably benign
Transcript: ENSMUST00000143264
Predicted Effect probably damaging
Transcript: ENSMUST00000178819
AA Change: P31T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000180544
AA Change: P382T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000205712
Predicted Effect probably benign
Transcript: ENSMUST00000205854
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit some postnatal lethality, altered craniofacial structures, kidney defects, embryonic hemorrhaging and cell migration defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T A 15: 74,538,321 W270R probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
App A T 16: 84,978,246 V501D probably benign Het
Cnot6l A G 5: 96,131,068 V97A possibly damaging Het
Cntrob A G 11: 69,300,295 L831P probably damaging Het
Dmbt1 T C 7: 131,037,890 S53P probably benign Het
Dnah2 T C 11: 69,430,835 D3833G probably damaging Het
Dock4 T C 12: 40,788,303 L1081P probably damaging Het
Dock7 T C 4: 99,001,098 N185D Het
Dsn1 T C 2: 157,006,012 probably benign Het
Evpl T C 11: 116,222,533 T1444A possibly damaging Het
Fanci T C 7: 79,444,711 L1130P probably benign Het
Fancm A G 12: 65,106,124 D1118G unknown Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gm11596 A G 11: 99,792,796 V166A unknown Het
Gm2696 A T 10: 77,814,889 T70S unknown Het
Gm5773 A G 3: 93,773,690 E223G probably damaging Het
Madd T A 2: 91,176,888 D293V probably damaging Het
Odam A G 5: 87,887,410 T78A possibly damaging Het
Olfr629 T A 7: 103,741,190 I17F probably damaging Het
Rassf3 A G 10: 121,417,079 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhbdf1 T C 11: 32,209,898 Y826C possibly damaging Het
Rnf13 C A 3: 57,764,308 Q14K probably benign Het
Sec13 A G 6: 113,729,640 S271P probably damaging Het
Sema6c T C 3: 95,172,309 L638P probably damaging Het
Sgsh T G 11: 119,347,735 H301P probably benign Het
Shh T C 5: 28,461,406 M161V possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stil C T 4: 115,030,001 H764Y probably damaging Het
Vmn1r203 C T 13: 22,524,535 T162I probably benign Het
Zzef1 T C 11: 72,821,896 M214T probably damaging Het
Other mutations in Zfp950
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB005:Zfp950 UTSW 19 61119500 missense probably damaging 1.00
R1892:Zfp950 UTSW 19 61119111 missense probably benign 0.05
R3442:Zfp950 UTSW 19 61118732 nonsense probably null
R6062:Zfp950 UTSW 19 61120425 missense possibly damaging 0.89
R7231:Zfp950 UTSW 19 61119212 missense probably benign 0.28
R7285:Zfp950 UTSW 19 61119112 missense probably benign 0.02
R7399:Zfp950 UTSW 19 61119155 missense probably damaging 1.00
R7727:Zfp950 UTSW 19 61119941 missense probably benign 0.33
R7744:Zfp950 UTSW 19 61127572 splice site probably null
R7811:Zfp950 UTSW 19 61119915 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGCAAAGGCTTTACCACAT -3'
(R):5'- AGCCTTTCCATGTTACAATCTTC -3'

Sequencing Primer
(F):5'- GACTGTTACGTGCAAAGGCTTTACC -3'
(R):5'- ACCCTATGAGTGTAATCAATGTGG -3'
Posted On2020-08-07