Incidental Mutation 'R7929:Kti12'
ID643462
Institutional Source Beutler Lab
Gene Symbol Kti12
Ensembl Gene ENSMUSG00000073775
Gene NameKTI12 homolog, chromatin associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7929 (G1)
Quality Score999
Status Validated
Chromosome4
Chromosomal Location108847785-108849413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108848246 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 119 (E119A)
Ref Sequence ENSEMBL: ENSMUSP00000099799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030296] [ENSMUST00000102738] [ENSMUST00000164855]
Predicted Effect probably benign
Transcript: ENSMUST00000030296
SMART Domains Protein: ENSMUSP00000030296
Gene: ENSMUSG00000028567

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:Thioredoxin_7 37 118 1.1e-19 PFAM
Pfam:Thioredoxin 41 135 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102738
AA Change: E119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099799
Gene: ENSMUSG00000073775
AA Change: E119A

DomainStartEndE-ValueType
Pfam:KTI12 1 347 3.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164855
SMART Domains Protein: ENSMUSP00000128780
Gene: ENSMUSG00000090551

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 47 64 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,978,520 I105F possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Adra1d G T 2: 131,561,680 C163* probably null Het
AI314180 A G 4: 58,869,554 C238R probably damaging Het
Ak9 A G 10: 41,383,948 D874G Het
Akap8 A T 17: 32,309,445 S498T probably damaging Het
Alyref2 C G 1: 171,503,839 F61L probably benign Het
Ank1 A T 8: 23,116,107 I1172F probably damaging Het
Ankrd50 A T 3: 38,457,109 F370I probably damaging Het
Apip A C 2: 103,083,021 T41P probably benign Het
Atg4d G A 9: 21,266,964 R126Q probably null Het
Ccdc129 G A 6: 55,897,961 V299M probably damaging Het
Ccdc86 A G 19: 10,948,819 S139P unknown Het
Ceacam16 A G 7: 19,853,631 L404P probably damaging Het
Dennd3 G T 15: 73,564,574 V1010L probably damaging Het
Disp1 A G 1: 183,135,539 S108P probably benign Het
Ephb2 A G 4: 136,660,884 V635A probably damaging Het
Fkbp3 A G 12: 65,070,038 probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gars A G 6: 55,063,117 H343R probably damaging Het
Gli2 A T 1: 118,842,042 N593K possibly damaging Het
Il18rap T A 1: 40,531,580 N227K probably damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Jak1 A T 4: 101,154,645 F1087I probably damaging Het
Klf16 A G 10: 80,576,864 S113P probably benign Het
Klhl30 A T 1: 91,355,516 E280V possibly damaging Het
Lama4 A G 10: 39,078,847 H1132R probably damaging Het
Lmtk3 A G 7: 45,795,148 D1085G unknown Het
Lrrc9 C A 12: 72,486,297 T980K possibly damaging Het
Nceh1 A G 3: 27,279,247 D164G probably benign Het
Nlrp2 A G 7: 5,327,499 S633P probably damaging Het
Nxn A G 11: 76,274,037 V216A possibly damaging Het
Odf4 A T 11: 68,922,933 V143D possibly damaging Het
Olfr1428 G A 19: 12,108,754 T38I unknown Het
Olfr475-ps1 T C 2: 88,623,875 Y191H unknown Het
Pex12 A G 11: 83,297,983 I62T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plekhg1 G A 10: 3,919,170 D237N probably damaging Het
Rxrb T A 17: 34,036,671 D377E probably benign Het
Ryr2 T A 13: 11,594,794 D4382V probably damaging Het
Ryr2 T A 13: 11,690,295 K2862* probably null Het
Ryr3 A G 2: 112,834,188 L1606P probably benign Het
Samd3 A G 10: 26,251,915 K270R probably damaging Het
Slc2a5 C A 4: 150,139,485 F211L probably benign Het
Spata31 T A 13: 64,921,718 V560D probably benign Het
Sri T G 5: 8,057,652 probably benign Het
Tbk1 A G 10: 121,557,233 C471R probably benign Het
Tbx20 A T 9: 24,725,763 S343T possibly damaging Het
Tesk2 A G 4: 116,802,255 E304G probably benign Het
Tle1 A G 4: 72,200,002 F2L possibly damaging Het
Tle4 G T 19: 14,517,880 P162T probably benign Het
Ttn G A 2: 76,843,472 P11172S unknown Het
Tulp1 T C 17: 28,353,772 N470S possibly damaging Het
Unc13b A G 4: 43,174,399 I1742M unknown Het
Vmn2r107 T G 17: 20,345,444 I7S probably null Het
Vmn2r91 T G 17: 18,107,644 I500R probably damaging Het
Xpnpep3 A G 15: 81,427,425 I111V probably damaging Het
Zp3r T A 1: 130,591,480 E308V probably benign Het
Other mutations in Kti12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02608:Kti12 APN 4 108848162 missense probably damaging 1.00
IGL02891:Kti12 APN 4 108848533 missense probably benign
IGL03142:Kti12 APN 4 108848165 missense probably damaging 1.00
BB002:Kti12 UTSW 4 108848246 missense probably benign
BB002:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB003:Kti12 UTSW 4 108848246 missense probably benign
BB003:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB004:Kti12 UTSW 4 108848246 missense probably benign
BB004:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB006:Kti12 UTSW 4 108848246 missense probably benign
BB006:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB012:Kti12 UTSW 4 108848246 missense probably benign
BB012:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB013:Kti12 UTSW 4 108848246 missense probably benign
BB013:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB014:Kti12 UTSW 4 108848246 missense probably benign
BB014:Kti12 UTSW 4 108848247 missense probably benign 0.00
BB016:Kti12 UTSW 4 108848246 missense probably benign
BB016:Kti12 UTSW 4 108848247 missense probably benign 0.00
R0518:Kti12 UTSW 4 108848579 missense possibly damaging 0.95
R1681:Kti12 UTSW 4 108848858 missense probably damaging 1.00
R5510:Kti12 UTSW 4 108848624 missense probably damaging 1.00
R5522:Kti12 UTSW 4 108848423 missense possibly damaging 0.58
R6652:Kti12 UTSW 4 108848533 missense probably benign 0.00
R6774:Kti12 UTSW 4 108848455 missense probably benign 0.12
R7123:Kti12 UTSW 4 108848482 missense probably benign 0.00
R7856:Kti12 UTSW 4 108848246 missense probably benign
R7856:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7858:Kti12 UTSW 4 108848246 missense probably benign
R7858:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7859:Kti12 UTSW 4 108848246 missense probably benign
R7859:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7914:Kti12 UTSW 4 108848246 missense probably benign
R7914:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7915:Kti12 UTSW 4 108848246 missense probably benign
R7915:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7916:Kti12 UTSW 4 108848246 missense probably benign
R7916:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7917:Kti12 UTSW 4 108848246 missense probably benign
R7917:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7918:Kti12 UTSW 4 108848246 missense probably benign
R7918:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7925:Kti12 UTSW 4 108848246 missense probably benign
R7925:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7926:Kti12 UTSW 4 108848246 missense probably benign
R7926:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7927:Kti12 UTSW 4 108848246 missense probably benign
R7927:Kti12 UTSW 4 108848247 missense probably benign 0.00
R7929:Kti12 UTSW 4 108848247 missense probably benign 0.00
R8099:Kti12 UTSW 4 108848374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTGACGCCAAACATCCG -3'
(R):5'- CTCTGGATCCAGTTCCTTTGAG -3'

Sequencing Primer
(F):5'- ATGGATGCCCCTGGAGATCATG -3'
(R):5'- GGATCCAGTTCCTTTGAGACAGC -3'
Posted On2020-08-07