Incidental Mutation 'R0053:Plin3'
ID64347
Institutional Source Beutler Lab
Gene Symbol Plin3
Ensembl Gene ENSMUSG00000024197
Gene Nameperilipin 3
SynonymsTip47, M6prbp1, 1300012C15Rik
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0053 (G1)
Quality Score179
Status Validated
Chromosome17
Chromosomal Location56278962-56290511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56279892 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 385 (D385G)
Ref Sequence ENSEMBL: ENSMUSP00000019726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019726] [ENSMUST00000058136]
PDB Structure
Crystal Structure of the C-terminus of TIP47 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000019726
AA Change: D385G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019726
Gene: ENSMUSG00000024197
AA Change: D385G

DomainStartEndE-ValueType
Pfam:Perilipin 19 415 1.5e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058136
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Meta Mutation Damage Score 0.6486 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a null mutation display enhanced cold tolerance and increased beige adipocyte formation and thermogenic activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Plin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Plin3 APN 17 56279814 missense probably damaging 1.00
IGL01522:Plin3 APN 17 56280799 nonsense probably null
IGL01793:Plin3 APN 17 56281540 missense probably benign
IGL02355:Plin3 APN 17 56286636 missense probably benign 0.24
IGL02362:Plin3 APN 17 56286636 missense probably benign 0.24
R0053:Plin3 UTSW 17 56279892 missense probably damaging 1.00
R1458:Plin3 UTSW 17 56284337 missense probably benign 0.05
R1900:Plin3 UTSW 17 56279824 missense possibly damaging 0.47
R2107:Plin3 UTSW 17 56284391 missense probably benign 0.01
R2173:Plin3 UTSW 17 56279891 missense possibly damaging 0.77
R3030:Plin3 UTSW 17 56284184 missense possibly damaging 0.64
R3808:Plin3 UTSW 17 56286275 missense probably damaging 1.00
R3872:Plin3 UTSW 17 56284181 missense probably damaging 1.00
R4426:Plin3 UTSW 17 56286555 missense probably damaging 1.00
R5991:Plin3 UTSW 17 56286576 missense probably damaging 0.99
R6261:Plin3 UTSW 17 56281488 nonsense probably null
R6516:Plin3 UTSW 17 56286223 missense probably damaging 0.99
R7225:Plin3 UTSW 17 56286541 missense possibly damaging 0.46
R7574:Plin3 UTSW 17 56284192 missense possibly damaging 0.95
R7786:Plin3 UTSW 17 56279757 missense probably benign 0.04
R8325:Plin3 UTSW 17 56286268 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAGATAGATGTTGGCCCTGAACC -3'
(R):5'- GGAGCCAAATTCCTGTCCTCCAAG -3'

Sequencing Primer
(F):5'- ATGTTGGCCCTGAACCTTCTC -3'
(R):5'- TGGCCCTCAATACCCTGAC -3'
Posted On2013-08-06