Incidental Mutation 'R0056:Mogat1'
ID64352
Institutional Source Beutler Lab
Gene Symbol Mogat1
Ensembl Gene ENSMUSG00000012187
Gene Namemonoacylglycerol O-acyltransferase 1
Synonyms1110064N14Rik, mDC2, 0610030A14Rik, Dgat2l1, MGAT1
MMRRC Submission 038350-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0056 (G1)
Quality Score96
Status Not validated
Chromosome1
Chromosomal Location78510991-78538173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78523770 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 157 (M157R)
Ref Sequence ENSEMBL: ENSMUSP00000109152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012331] [ENSMUST00000113524] [ENSMUST00000134947] [ENSMUST00000149732] [ENSMUST00000152111]
Predicted Effect probably damaging
Transcript: ENSMUST00000012331
AA Change: M157R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000012331
Gene: ENSMUSG00000012187
AA Change: M157R

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113524
AA Change: M157R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109152
Gene: ENSMUSG00000012187
AA Change: M157R

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134947
AA Change: M157R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116178
Gene: ENSMUSG00000012187
AA Change: M157R

DomainStartEndE-ValueType
Pfam:DAGAT 40 201 2.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149732
AA Change: M126R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117903
Gene: ENSMUSG00000012187
AA Change: M126R

DomainStartEndE-ValueType
Pfam:DAGAT 9 247 3.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152111
SMART Domains Protein: ENSMUSP00000123427
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 40 82 1.9e-9 PFAM
Meta Mutation Damage Score 0.3443 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerols, the precursor of physiologically important lipids such as triacylglycerol and phospholipids (Yen et al., 2002 [PubMed 12077311]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight in female, but not, male mice and does not ameliorate hepatic steatosis in lipodystrophic or obese mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 A T 6: 118,405,229 D449E probably benign Het
Etv3 T C 3: 87,535,828 Y240H possibly damaging Het
Fscb T G 12: 64,474,247 R148S possibly damaging Het
Mapk6 A G 9: 75,388,816 Y467H possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Pold2 T A 11: 5,872,338 S444C possibly damaging Het
Robo4 G A 9: 37,404,477 R342Q probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Stk10 T A 11: 32,617,851 N884K possibly damaging Het
Tex15 A G 8: 33,582,027 H2534R probably benign Het
Ticam2 G T 18: 46,560,334 Q229K possibly damaging Het
Other mutations in Mogat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0357:Mogat1 UTSW 1 78512040 missense probably benign 0.01
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1716:Mogat1 UTSW 1 78538044 missense probably benign 0.01
R3799:Mogat1 UTSW 1 78529138 missense probably benign 0.00
R4168:Mogat1 UTSW 1 78512035 missense possibly damaging 0.77
R5485:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R5929:Mogat1 UTSW 1 78523733 missense probably benign 0.00
R6640:Mogat1 UTSW 1 78523774 missense probably damaging 0.99
R6841:Mogat1 UTSW 1 78522859 missense probably damaging 1.00
R7842:Mogat1 UTSW 1 78522865 critical splice donor site probably null
R8179:Mogat1 UTSW 1 78527618 missense possibly damaging 0.58
Z1177:Mogat1 UTSW 1 78529253 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATGGGAACCCTTCCACTTCTCAC -3'
(R):5'- ACATCAAGCAACTGCTGCTGCC -3'

Sequencing Primer
(F):5'- TGTAGCTTGTCAAAACGCAG -3'
(R):5'- CTGCCACCCCAGAGCAC -3'
Posted On2013-08-06