Incidental Mutation 'R7930:Capn5'
ID643526
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Namecalpain 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7930 (G1)
Quality Score999
Status Not validated
Chromosome7
Chromosomal Location98121559-98178274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98123878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 640 (V640I)
Ref Sequence ENSEMBL: ENSMUSP00000048183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627]
Predicted Effect probably benign
Transcript: ENSMUST00000040971
AA Change: V640I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: V640I

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107112
AA Change: V640I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: V640I

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,675,756 C609* probably null Het
Adam20 C T 8: 40,797,070 T739I probably benign Het
Adam23 G T 1: 63,585,427 V805F possibly damaging Het
Adamts17 A T 7: 66,849,799 R31S probably damaging Het
Ahnak2 T C 12: 112,779,125 E629G Het
Ano4 T A 10: 89,327,276 Y27F possibly damaging Het
Bbs2 A G 8: 94,069,997 V675A probably damaging Het
Brca2 A G 5: 150,558,510 E2839G probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Casp4 C T 9: 5,321,318 T23M probably damaging Het
Cerk C T 15: 86,144,719 E379K possibly damaging Het
Comp G A 8: 70,373,853 G26D probably damaging Het
Cpxm1 G A 2: 130,395,062 A220V possibly damaging Het
Cyp2c69 G T 19: 39,842,990 P460T possibly damaging Het
Ddx23 T C 15: 98,648,623 D555G probably damaging Het
Dusp9 AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG X: 73,640,522 probably benign Het
E2f6 T A 12: 16,819,057 I127K probably damaging Het
Efr3a T A 15: 65,861,740 D716E probably benign Het
Esp16 T G 17: 39,539,977 S82R possibly damaging Het
Fasn A C 11: 120,809,235 S2199A probably benign Het
Fscb A G 12: 64,472,563 S710P unknown Het
Gas7 A G 11: 67,665,391 I185M probably damaging Het
Glg1 A T 8: 111,160,735 L1047I possibly damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm7876 A T 14: 4,711,357 I124L possibly damaging Het
Golga5 A G 12: 102,484,422 N445D probably benign Het
Grin2c A T 11: 115,256,237 H377Q probably benign Het
Hmgcs1 T C 13: 119,699,963 I97T possibly damaging Het
Ifi211 T C 1: 173,906,203 T131A possibly damaging Het
Ifngr1 A G 10: 19,609,183 K310R probably damaging Het
Il18rap T C 1: 40,548,643 V467A probably damaging Het
Itgad C A 7: 128,183,108 Q239K probably benign Het
Jrkl T C 9: 13,245,501 I52V possibly damaging Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Krt75 C A 15: 101,564,883 *552L probably null Het
Mbd2 A G 18: 70,568,877 D154G probably damaging Het
Muc4 C CTAG 16: 32,754,078 probably benign Het
Mutyh A T 4: 116,816,956 N235Y probably benign Het
Myo5b A G 18: 74,731,754 T1348A probably benign Het
Ndufs7 T C 10: 80,253,785 probably null Het
Nup205 T G 6: 35,194,576 M458R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1061 T A 2: 86,413,216 T279S probably damaging Het
Olfr1416 T A 1: 92,479,848 M258L probably benign Het
Olfr1475 G A 19: 13,479,655 P181L probably damaging Het
Olfr350 G T 2: 36,850,273 V76F probably damaging Het
Olfr392 A C 11: 73,815,100 probably benign Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr888 A G 9: 38,108,968 N89S possibly damaging Het
Plcl2 T G 17: 50,606,803 I280S probably benign Het
Ppargc1a A T 5: 51,472,922 Y618N unknown Het
Rab43 A T 6: 87,811,366 I60N probably damaging Het
Rnf126 A T 10: 79,760,892 C231S probably damaging Het
Rnf220 T A 4: 117,307,590 E238D probably damaging Het
Scn9a A T 2: 66,504,849 D1265E probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sntb2 T A 8: 107,001,637 S406T probably damaging Het
Sos1 T C 17: 80,406,838 I1068V probably benign Het
Spg20 A G 3: 55,128,276 K519E probably damaging Het
Tlx3 A T 11: 33,203,058 F134L probably damaging Het
Trbj1-2 A T 6: 41,534,030 T10S Het
Txk A C 5: 72,735,193 L33R probably damaging Het
Ulk2 A G 11: 61,791,432 probably null Het
Usp20 T C 2: 31,010,544 S357P probably benign Het
Wac T A 18: 7,921,560 N565K possibly damaging Het
Zfp709 G T 8: 71,890,840 K704N probably damaging Het
Zfp788 C T 7: 41,649,625 Q562* probably null Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 98135764 missense probably damaging 1.00
IGL01311:Capn5 APN 7 98161923 missense probably damaging 1.00
IGL01768:Capn5 APN 7 98125273 missense probably damaging 1.00
IGL01926:Capn5 APN 7 98128472 critical splice donor site probably null
IGL02076:Capn5 APN 7 98131743 nonsense probably null
IGL02505:Capn5 APN 7 98131196 missense possibly damaging 0.85
BB007:Capn5 UTSW 7 98123878 missense probably benign
BB017:Capn5 UTSW 7 98123878 missense probably benign
PIT4466001:Capn5 UTSW 7 98123988 missense probably benign 0.00
R0178:Capn5 UTSW 7 98132891 missense probably damaging 1.00
R0518:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R0521:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R1459:Capn5 UTSW 7 98131842 missense possibly damaging 0.84
R2005:Capn5 UTSW 7 98129363 missense probably benign
R2258:Capn5 UTSW 7 98135875 missense probably damaging 0.99
R2327:Capn5 UTSW 7 98126367 missense probably benign 0.07
R3797:Capn5 UTSW 7 98125829 missense probably null 0.77
R4032:Capn5 UTSW 7 98129246 missense probably damaging 0.96
R4620:Capn5 UTSW 7 98129371 missense probably damaging 0.98
R4717:Capn5 UTSW 7 98123919 missense probably benign 0.02
R4777:Capn5 UTSW 7 98131718 missense probably damaging 1.00
R4823:Capn5 UTSW 7 98126441 missense probably damaging 1.00
R4841:Capn5 UTSW 7 98131672 splice site probably null
R4965:Capn5 UTSW 7 98126417 missense probably damaging 0.99
R5568:Capn5 UTSW 7 98125930 missense probably damaging 1.00
R5732:Capn5 UTSW 7 98129386 missense possibly damaging 0.95
R5792:Capn5 UTSW 7 98131195 missense probably benign 0.09
R6892:Capn5 UTSW 7 98135941 missense probably damaging 1.00
R6923:Capn5 UTSW 7 98129254 missense probably damaging 1.00
R7095:Capn5 UTSW 7 98125831 missense probably benign 0.10
R7391:Capn5 UTSW 7 98131219 missense probably benign 0.02
R7553:Capn5 UTSW 7 98124024 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGGTAGAGAGAACTGC -3'
(R):5'- TTGGAATCACCGAGTCCTGAAG -3'

Sequencing Primer
(F):5'- CCACAAGACGGGAATTCTTTG -3'
(R):5'- GGATGAATTCCTGGGCCAG -3'
Posted On2020-08-07