Incidental Mutation 'R7930:Capn5'
ID 643526
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 045977-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7930 (G1)
Quality Score 999
Status Not validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 97773085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 640 (V640I)
Ref Sequence ENSEMBL: ENSMUSP00000048183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627]
AlphaFold O08688
Predicted Effect probably benign
Transcript: ENSMUST00000040971
AA Change: V640I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: V640I

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107112
AA Change: V640I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: V640I

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107127
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107128
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138627
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 C T 8: 41,250,107 (GRCm39) T739I probably benign Het
Adam23 G T 1: 63,624,586 (GRCm39) V805F possibly damaging Het
Adamts17 A T 7: 66,499,547 (GRCm39) R31S probably damaging Het
Ahnak2 T C 12: 112,745,560 (GRCm39) E629G Het
Ano4 T A 10: 89,163,138 (GRCm39) Y27F possibly damaging Het
Bbs2 A G 8: 94,796,625 (GRCm39) V675A probably damaging Het
Brca2 A G 5: 150,481,975 (GRCm39) E2839G probably damaging Het
Casp4 C T 9: 5,321,318 (GRCm39) T23M probably damaging Het
Cerk C T 15: 86,028,920 (GRCm39) E379K possibly damaging Het
Comp G A 8: 70,826,503 (GRCm39) G26D probably damaging Het
Cpxm1 G A 2: 130,236,982 (GRCm39) A220V possibly damaging Het
Cracd GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 77,004,801 (GRCm39) probably benign Het
Cyp2c69 G T 19: 39,831,434 (GRCm39) P460T possibly damaging Het
Ddx23 T C 15: 98,546,504 (GRCm39) D555G probably damaging Het
Dusp9 AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG X: 72,684,128 (GRCm39) probably benign Het
E2f6 T A 12: 16,869,058 (GRCm39) I127K probably damaging Het
Efr3a T A 15: 65,733,589 (GRCm39) D716E probably benign Het
Esp16 T G 17: 39,850,868 (GRCm39) S82R possibly damaging Het
Fasn A C 11: 120,700,061 (GRCm39) S2199A probably benign Het
Fscb A G 12: 64,519,337 (GRCm39) S710P unknown Het
Gas7 A G 11: 67,556,217 (GRCm39) I185M probably damaging Het
Glg1 A T 8: 111,887,367 (GRCm39) L1047I possibly damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,497,379 (GRCm39) probably benign Het
Gm7876 A T 14: 4,711,357 (GRCm38) I124L possibly damaging Het
Golga5 A G 12: 102,450,681 (GRCm39) N445D probably benign Het
Grin2c A T 11: 115,147,063 (GRCm39) H377Q probably benign Het
Hmgcs1 T C 13: 120,161,499 (GRCm39) I97T possibly damaging Het
Ifi211 T C 1: 173,733,769 (GRCm39) T131A possibly damaging Het
Ifngr1 A G 10: 19,484,931 (GRCm39) K310R probably damaging Het
Il18rap T C 1: 40,587,803 (GRCm39) V467A probably damaging Het
Itgad C A 7: 127,782,280 (GRCm39) Q239K probably benign Het
Jrkl T C 9: 13,245,506 (GRCm39) I52V possibly damaging Het
Kdm6b A T 11: 69,290,778 (GRCm39) D1630E unknown Het
Krt75 C A 15: 101,473,318 (GRCm39) *552L probably null Het
Mbd2 A G 18: 70,701,948 (GRCm39) D154G probably damaging Het
Muc4 C CTAG 16: 32,575,369 (GRCm39) probably benign Het
Mutyh A T 4: 116,674,153 (GRCm39) N235Y probably benign Het
Myo5b A G 18: 74,864,825 (GRCm39) T1348A probably benign Het
Ndufs7 T C 10: 80,089,619 (GRCm39) probably null Het
Nup205 T G 6: 35,171,511 (GRCm39) M458R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or1e32 A C 11: 73,705,926 (GRCm39) probably benign Het
Or1j4 G T 2: 36,740,285 (GRCm39) V76F probably damaging Het
Or2at1 A T 7: 99,416,803 (GRCm39) T145S probably benign Het
Or5b119 G A 19: 13,457,019 (GRCm39) P181L probably damaging Het
Or6b2 T A 1: 92,407,570 (GRCm39) M258L probably benign Het
Or8b101 A G 9: 38,020,264 (GRCm39) N89S possibly damaging Het
Or8k25 T A 2: 86,243,560 (GRCm39) T279S probably damaging Het
Plcl2 T G 17: 50,913,831 (GRCm39) I280S probably benign Het
Ppargc1a A T 5: 51,630,264 (GRCm39) Y618N unknown Het
Rab43 A T 6: 87,788,348 (GRCm39) I60N probably damaging Het
Rnf126 A T 10: 79,596,726 (GRCm39) C231S probably damaging Het
Rnf220 T A 4: 117,164,787 (GRCm39) E238D probably damaging Het
Scn9a A T 2: 66,335,193 (GRCm39) D1265E probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,640,271 (GRCm39) probably benign Het
Sntb2 T A 8: 107,728,269 (GRCm39) S406T probably damaging Het
Sos1 T C 17: 80,714,267 (GRCm39) I1068V probably benign Het
Spart A G 3: 55,035,697 (GRCm39) K519E probably damaging Het
Tlx3 A T 11: 33,153,058 (GRCm39) F134L probably damaging Het
Trbj1-2 A T 6: 41,510,964 (GRCm39) T10S Het
Txk A C 5: 72,892,536 (GRCm39) L33R probably damaging Het
Ulk2 A G 11: 61,682,258 (GRCm39) probably null Het
Usp20 T C 2: 30,900,556 (GRCm39) S357P probably benign Het
Wac T A 18: 7,921,560 (GRCm39) N565K possibly damaging Het
Zfp1007 A T 5: 109,823,622 (GRCm39) C609* probably null Het
Zfp709 G T 8: 72,644,684 (GRCm39) K704N probably damaging Het
Zfp788 C T 7: 41,299,049 (GRCm39) Q562* probably null Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGGTAGAGAGAACTGC -3'
(R):5'- TTGGAATCACCGAGTCCTGAAG -3'

Sequencing Primer
(F):5'- CCACAAGACGGGAATTCTTTG -3'
(R):5'- GGATGAATTCCTGGGCCAG -3'
Posted On 2020-08-07