Incidental Mutation 'R7930:Olfr521'
ID643527
Institutional Source Beutler Lab
Gene Symbol Olfr521
Ensembl Gene ENSMUSG00000073997
Gene Nameolfactory receptor 521
SynonymsMOR101-2, GA_x6K02T2PBJ9-2443810-2444775
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7930 (G1)
Quality Score999
Status Not validated
Chromosome7
Chromosomal Location99763507-99769321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99767596 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 145 (T145S)
Ref Sequence ENSEMBL: ENSMUSP00000151473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098263] [ENSMUST00000219663] [ENSMUST00000220001]
Predicted Effect probably benign
Transcript: ENSMUST00000098263
AA Change: T145S

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095863
Gene: ENSMUSG00000073997
AA Change: T145S

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.4e-63 PFAM
Pfam:7TM_GPCR_Srsx 40 310 7.4e-6 PFAM
Pfam:7tm_1 46 309 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219663
AA Change: T145S

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000220001
AA Change: T145S

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,675,756 C609* probably null Het
Adam20 C T 8: 40,797,070 T739I probably benign Het
Adam23 G T 1: 63,585,427 V805F possibly damaging Het
Adamts17 A T 7: 66,849,799 R31S probably damaging Het
Ahnak2 T C 12: 112,779,125 E629G Het
Ano4 T A 10: 89,327,276 Y27F possibly damaging Het
Bbs2 A G 8: 94,069,997 V675A probably damaging Het
Brca2 A G 5: 150,558,510 E2839G probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Capn5 C T 7: 98,123,878 V640I probably benign Het
Casp4 C T 9: 5,321,318 T23M probably damaging Het
Cerk C T 15: 86,144,719 E379K possibly damaging Het
Comp G A 8: 70,373,853 G26D probably damaging Het
Cpxm1 G A 2: 130,395,062 A220V possibly damaging Het
Cyp2c69 G T 19: 39,842,990 P460T possibly damaging Het
Ddx23 T C 15: 98,648,623 D555G probably damaging Het
Dusp9 AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG X: 73,640,522 probably benign Het
E2f6 T A 12: 16,819,057 I127K probably damaging Het
Efr3a T A 15: 65,861,740 D716E probably benign Het
Esp16 T G 17: 39,539,977 S82R possibly damaging Het
Fasn A C 11: 120,809,235 S2199A probably benign Het
Fscb A G 12: 64,472,563 S710P unknown Het
Gas7 A G 11: 67,665,391 I185M probably damaging Het
Glg1 A T 8: 111,160,735 L1047I possibly damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm7876 A T 14: 4,711,357 I124L possibly damaging Het
Golga5 A G 12: 102,484,422 N445D probably benign Het
Grin2c A T 11: 115,256,237 H377Q probably benign Het
Hmgcs1 T C 13: 119,699,963 I97T possibly damaging Het
Ifi211 T C 1: 173,906,203 T131A possibly damaging Het
Ifngr1 A G 10: 19,609,183 K310R probably damaging Het
Il18rap T C 1: 40,548,643 V467A probably damaging Het
Itgad C A 7: 128,183,108 Q239K probably benign Het
Jrkl T C 9: 13,245,501 I52V possibly damaging Het
Kdm6b A T 11: 69,399,952 D1630E unknown Het
Krt75 C A 15: 101,564,883 *552L probably null Het
Mbd2 A G 18: 70,568,877 D154G probably damaging Het
Muc4 C CTAG 16: 32,754,078 probably benign Het
Mutyh A T 4: 116,816,956 N235Y probably benign Het
Myo5b A G 18: 74,731,754 T1348A probably benign Het
Ndufs7 T C 10: 80,253,785 probably null Het
Nup205 T G 6: 35,194,576 M458R probably damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1061 T A 2: 86,413,216 T279S probably damaging Het
Olfr1416 T A 1: 92,479,848 M258L probably benign Het
Olfr1475 G A 19: 13,479,655 P181L probably damaging Het
Olfr350 G T 2: 36,850,273 V76F probably damaging Het
Olfr392 A C 11: 73,815,100 probably benign Het
Olfr888 A G 9: 38,108,968 N89S possibly damaging Het
Plcl2 T G 17: 50,606,803 I280S probably benign Het
Ppargc1a A T 5: 51,472,922 Y618N unknown Het
Rab43 A T 6: 87,811,366 I60N probably damaging Het
Rnf126 A T 10: 79,760,892 C231S probably damaging Het
Rnf220 T A 4: 117,307,590 E238D probably damaging Het
Scn9a A T 2: 66,504,849 D1265E probably damaging Het
Sf3a2 ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT 10: 80,804,437 probably benign Het
Sntb2 T A 8: 107,001,637 S406T probably damaging Het
Sos1 T C 17: 80,406,838 I1068V probably benign Het
Spg20 A G 3: 55,128,276 K519E probably damaging Het
Tlx3 A T 11: 33,203,058 F134L probably damaging Het
Trbj1-2 A T 6: 41,534,030 T10S Het
Txk A C 5: 72,735,193 L33R probably damaging Het
Ulk2 A G 11: 61,791,432 probably null Het
Usp20 T C 2: 31,010,544 S357P probably benign Het
Wac T A 18: 7,921,560 N565K possibly damaging Het
Zfp709 G T 8: 71,890,840 K704N probably damaging Het
Zfp788 C T 7: 41,649,625 Q562* probably null Het
Other mutations in Olfr521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02303:Olfr521 APN 7 99767972 missense possibly damaging 0.73
IGL02491:Olfr521 APN 7 99767333 missense possibly damaging 0.85
BB007:Olfr521 UTSW 7 99767596 missense probably benign 0.37
BB017:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R0544:Olfr521 UTSW 7 99767660 missense probably benign
R1029:Olfr521 UTSW 7 99767224 missense probably benign 0.01
R1840:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R4709:Olfr521 UTSW 7 99767782 missense probably damaging 1.00
R5215:Olfr521 UTSW 7 99767510 missense probably damaging 1.00
R5752:Olfr521 UTSW 7 99767948 missense probably benign 0.00
R5934:Olfr521 UTSW 7 99767389 missense probably damaging 1.00
R6913:Olfr521 UTSW 7 99767717 missense probably damaging 1.00
R7394:Olfr521 UTSW 7 99767346 missense probably damaging 1.00
R7554:Olfr521 UTSW 7 99768003 missense possibly damaging 0.62
R8332:Olfr521 UTSW 7 99768127 makesense probably null
Z1177:Olfr521 UTSW 7 99767914 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCAACCTCTCGGCTCTAGAC -3'
(R):5'- CAGAAGCCCATGAGTGTCTG -3'

Sequencing Primer
(F):5'- ACTGTCCCGAAGATGCTGTC -3'
(R):5'- CCCATGAGTGTCTGGGGAG -3'
Posted On2020-08-07