Incidental Mutation 'R0056:Etv3'
ID64353
Institutional Source Beutler Lab
Gene Symbol Etv3
Ensembl Gene ENSMUSG00000003382
Gene Nameets variant 3
SynonymsETS-domain transcriptional repressor, Pe1, METS
MMRRC Submission 038350-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0056 (G1)
Quality Score85
Status Not validated
Chromosome3
Chromosomal Location87525407-87540156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87535828 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 240 (Y240H)
Ref Sequence ENSEMBL: ENSMUSP00000127419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117293] [ENSMUST00000119109] [ENSMUST00000170036]
Predicted Effect probably benign
Transcript: ENSMUST00000117293
SMART Domains Protein: ENSMUSP00000114047
Gene: ENSMUSG00000003382

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119109
AA Change: Y240H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112915
Gene: ENSMUSG00000003382
AA Change: Y240H

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152010
Predicted Effect possibly damaging
Transcript: ENSMUST00000170036
AA Change: Y240H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127419
Gene: ENSMUSG00000003382
AA Change: Y240H

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 A T 6: 118,405,229 D449E probably benign Het
Fscb T G 12: 64,474,247 R148S possibly damaging Het
Mapk6 A G 9: 75,388,816 Y467H possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mogat1 T G 1: 78,523,770 M157R probably damaging Het
Pold2 T A 11: 5,872,338 S444C possibly damaging Het
Robo4 G A 9: 37,404,477 R342Q probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Stk10 T A 11: 32,617,851 N884K possibly damaging Het
Tex15 A G 8: 33,582,027 H2534R probably benign Het
Ticam2 G T 18: 46,560,334 Q229K possibly damaging Het
Other mutations in Etv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Etv3 APN 3 87535718 missense possibly damaging 0.68
IGL02613:Etv3 APN 3 87536395 missense possibly damaging 0.53
IGL02698:Etv3 APN 3 87536578 missense possibly damaging 0.53
Rodeo UTSW 3 87536031 nonsense probably null
Schooled UTSW 3 87529270 missense probably damaging 1.00
R2074:Etv3 UTSW 3 87536219 missense probably benign
R2104:Etv3 UTSW 3 87536062 missense possibly damaging 0.53
R4120:Etv3 UTSW 3 87536282 missense probably benign 0.00
R4923:Etv3 UTSW 3 87535916 missense possibly damaging 0.96
R4960:Etv3 UTSW 3 87528061 missense probably damaging 1.00
R5642:Etv3 UTSW 3 87536015 missense possibly damaging 0.96
R5907:Etv3 UTSW 3 87535543 missense probably benign 0.23
R6020:Etv3 UTSW 3 87529364 missense probably benign
R6882:Etv3 UTSW 3 87529270 missense probably damaging 1.00
R7515:Etv3 UTSW 3 87528056 missense possibly damaging 0.58
R7570:Etv3 UTSW 3 87536031 nonsense probably null
R8340:Etv3 UTSW 3 87536549 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTCTCCTACTGGCGATGTGCAACC -3'
(R):5'- TGGTAGTTGAACACCGAACAGGC -3'

Sequencing Primer
(F):5'- CTGAGTCAGGGGTTACCACTG -3'
(R):5'- ATGAAGGTAGTGTTTCATTTCCTC -3'
Posted On2013-08-06