Incidental Mutation 'R0056:Bms1'
ID64354
Institutional Source Beutler Lab
Gene Symbol Bms1
Ensembl Gene ENSMUSG00000030138
Gene NameBMS1, ribosome biogenesis factor
SynonymsBms1l
MMRRC Submission 038350-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0056 (G1)
Quality Score98
Status Not validated
Chromosome6
Chromosomal Location118383381-118419474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118405229 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 449 (D449E)
Ref Sequence ENSEMBL: ENSMUSP00000032237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032237]
Predicted Effect probably benign
Transcript: ENSMUST00000032237
AA Change: D449E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138
AA Change: D449E

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205207
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Etv3 T C 3: 87,535,828 Y240H possibly damaging Het
Fscb T G 12: 64,474,247 R148S possibly damaging Het
Mapk6 A G 9: 75,388,816 Y467H possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mogat1 T G 1: 78,523,770 M157R probably damaging Het
Pold2 T A 11: 5,872,338 S444C possibly damaging Het
Robo4 G A 9: 37,404,477 R342Q probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Stk10 T A 11: 32,617,851 N884K possibly damaging Het
Tex15 A G 8: 33,582,027 H2534R probably benign Het
Ticam2 G T 18: 46,560,334 Q229K possibly damaging Het
Other mutations in Bms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bms1 APN 6 118404583 missense probably benign 0.01
IGL00763:Bms1 APN 6 118418402 splice site probably benign
IGL00839:Bms1 APN 6 118405291 missense probably benign 0.30
IGL02005:Bms1 APN 6 118404585 missense probably damaging 1.00
IGL02271:Bms1 APN 6 118389329 missense probably benign 0.10
IGL02403:Bms1 APN 6 118405224 missense possibly damaging 0.89
IGL02474:Bms1 APN 6 118416519 missense probably benign 0.00
IGL03230:Bms1 APN 6 118418561 missense possibly damaging 0.88
IGL03277:Bms1 APN 6 118405122 missense probably benign
PIT4508001:Bms1 UTSW 6 118383806 missense probably benign 0.03
R0028:Bms1 UTSW 6 118416519 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0276:Bms1 UTSW 6 118408134 missense possibly damaging 0.87
R0295:Bms1 UTSW 6 118389337 missense probably benign 0.04
R0360:Bms1 UTSW 6 118405290 missense probably benign 0.13
R0556:Bms1 UTSW 6 118413179 missense probably damaging 1.00
R1078:Bms1 UTSW 6 118405221 missense probably benign 0.00
R1583:Bms1 UTSW 6 118389389 splice site probably benign
R1815:Bms1 UTSW 6 118383781 missense probably damaging 1.00
R1957:Bms1 UTSW 6 118392978 missense probably damaging 0.98
R2045:Bms1 UTSW 6 118392627 missense probably damaging 1.00
R2511:Bms1 UTSW 6 118391153 splice site probably null
R4293:Bms1 UTSW 6 118405347 splice site probably null
R4296:Bms1 UTSW 6 118404999 missense probably damaging 0.96
R4467:Bms1 UTSW 6 118383847 missense probably damaging 0.99
R4688:Bms1 UTSW 6 118392706 missense probably damaging 1.00
R4718:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R5015:Bms1 UTSW 6 118404263 nonsense probably null
R5327:Bms1 UTSW 6 118405218 missense possibly damaging 0.53
R5489:Bms1 UTSW 6 118413745 missense possibly damaging 0.64
R5511:Bms1 UTSW 6 118388887 missense possibly damaging 0.85
R5636:Bms1 UTSW 6 118388825 missense probably benign 0.00
R5815:Bms1 UTSW 6 118404279 missense probably damaging 1.00
R6245:Bms1 UTSW 6 118396836 missense probably damaging 0.96
R6299:Bms1 UTSW 6 118418515 missense probably damaging 0.98
R6389:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R6838:Bms1 UTSW 6 118416494 missense probably benign 0.00
R7129:Bms1 UTSW 6 118403161 nonsense probably null
R7414:Bms1 UTSW 6 118383745 missense possibly damaging 0.93
R7811:Bms1 UTSW 6 118403138 missense probably damaging 0.99
R7883:Bms1 UTSW 6 118388774 missense probably benign 0.04
R7966:Bms1 UTSW 6 118388774 missense probably benign 0.04
R8046:Bms1 UTSW 6 118408144 missense probably benign
R8068:Bms1 UTSW 6 118413750 missense probably damaging 1.00
R8098:Bms1 UTSW 6 118384258 missense probably damaging 0.98
X0067:Bms1 UTSW 6 118404834 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTCTCCAACAGAGCCGCATTCC -3'
(R):5'- TGCATAGTGGACTGGCATTAGCTTC -3'

Sequencing Primer
(F):5'- TCAAGGTCATCATCGCTATCAG -3'
(R):5'- GGCATTAGCTTCTTACTGCACAG -3'
Posted On2013-08-06