Mutagenetix > Incidental Mutation

Incidental Mutation 'R0056:Robo4'

64357

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

Magic roundabout, 1200012D01Rik

MMRRC Submission

038350-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R0056 (G1)

Quality Score

108

Status

Not validated

Chromosome

Chromosomal Location

37313198-37325319 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 37315773 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 342 (R342Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]

AlphaFold

Q8C310

Predicted Effect

probably benign
Transcript: ENSMUST00000102895
AA Change: R342Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: R342Q

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115046
AA Change: R342Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: R342Q

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115048
AA Change: R231Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: R231Q

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972

Predicted Effect

probably benign
Transcript: ENSMUST00000214185
AA Change: R342Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.0812

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bms1	A	T	6: 118,382,190 (GRCm39)	D449E	probably benign	Het
Etv3	T	C	3: 87,443,135 (GRCm39)	Y240H	possibly damaging	Het
Fscb	T	G	12: 64,521,021 (GRCm39)	R148S	possibly damaging	Het
Mapk6	A	G	9: 75,296,098 (GRCm39)	Y467H	possibly damaging	Het
Marf1	C	T	16: 13,960,398 (GRCm39)	A549T	probably damaging	Het
Mogat1	T	G	1: 78,500,407 (GRCm39)	M157R	probably damaging	Het
Pold2	T	A	11: 5,822,338 (GRCm39)	S444C	possibly damaging	Het
Satb1	T	A	17: 52,047,231 (GRCm39)	I695F	probably damaging	Het
Snapc1	C	T	12: 74,021,806 (GRCm39)	R81C	probably damaging	Het
Stk10	T	A	11: 32,567,851 (GRCm39)	N884K	possibly damaging	Het
Tex15	A	G	8: 34,072,055 (GRCm39)	H2534R	probably benign	Het
Ticam2	G	T	18: 46,693,401 (GRCm39)	Q229K	possibly damaging	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37,322,400 (GRCm39)	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37,319,525 (GRCm39)	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37,317,231 (GRCm39)	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37,319,507 (GRCm39)	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37,317,296 (GRCm39)	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37,324,336 (GRCm39)	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37,319,496 (GRCm39)	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37,319,670 (GRCm39)	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37,324,678 (GRCm39)	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37,319,472 (GRCm39)	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37,321,765 (GRCm39)	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37,315,580 (GRCm39)	splice site	probably benign
IGL03102:Robo4	APN	9	37,315,481 (GRCm39)	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37,317,106 (GRCm39)	intron	probably benign
PIT4305001:Robo4	UTSW	9	37,322,687 (GRCm39)	missense	probably damaging	1.00
R0068:Robo4	UTSW	9	37,315,773 (GRCm39)	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37,313,977 (GRCm39)	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37,313,977 (GRCm39)	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37,316,062 (GRCm39)	splice site	probably benign
R1005:Robo4	UTSW	9	37,319,547 (GRCm39)	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37,324,348 (GRCm39)	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37,319,348 (GRCm39)	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37,322,136 (GRCm39)	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37,319,372 (GRCm39)	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37,314,523 (GRCm39)	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37,314,739 (GRCm39)	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37,324,355 (GRCm39)	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37,315,366 (GRCm39)	splice site	probably benign
R2203:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2204:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2351:Robo4	UTSW	9	37,322,956 (GRCm39)	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37,313,958 (GRCm39)	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37,315,772 (GRCm39)	nonsense	probably null
R2851:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2852:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2877:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3123:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3124:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3125:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3805:Robo4	UTSW	9	37,315,734 (GRCm39)	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37,315,734 (GRCm39)	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3905:Robo4	UTSW	9	37,314,801 (GRCm39)	nonsense	probably null
R3938:Robo4	UTSW	9	37,313,313 (GRCm39)	start gained	probably benign
R4261:Robo4	UTSW	9	37,316,877 (GRCm39)	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4435:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4561:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4562:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4568:Robo4	UTSW	9	37,316,118 (GRCm39)	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37,314,495 (GRCm39)	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37,313,856 (GRCm39)	missense	probably benign
R5000:Robo4	UTSW	9	37,319,664 (GRCm39)	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37,316,102 (GRCm39)	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37,319,256 (GRCm39)	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37,319,256 (GRCm39)	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5279:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5285:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5347:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5348:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5361:Robo4	UTSW	9	37,324,674 (GRCm39)	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5404:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5488:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5489:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5490:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5494:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5629:Robo4	UTSW	9	37,319,658 (GRCm39)	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37,316,093 (GRCm39)	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37,322,970 (GRCm39)	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37,322,696 (GRCm39)	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37,316,926 (GRCm39)	nonsense	probably null
R6189:Robo4	UTSW	9	37,314,829 (GRCm39)	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37,322,008 (GRCm39)	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37,315,664 (GRCm39)	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37,313,363 (GRCm39)	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37,314,001 (GRCm39)	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37,322,277 (GRCm39)	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37,314,105 (GRCm39)	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37,316,870 (GRCm39)	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37,324,418 (GRCm39)	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37,322,055 (GRCm39)	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37,313,931 (GRCm39)	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37,316,936 (GRCm39)	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37,315,372 (GRCm39)	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37,314,801 (GRCm39)	nonsense	probably null
R8547:Robo4	UTSW	9	37,315,674 (GRCm39)	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37,319,577 (GRCm39)	missense	possibly damaging	0.92
R8836:Robo4	UTSW	9	37,317,130 (GRCm39)	missense	unknown
R8889:Robo4	UTSW	9	37,314,601 (GRCm39)	missense	probably benign	0.00
R9018:Robo4	UTSW	9	37,315,520 (GRCm39)	missense	probably benign	0.00
R9182:Robo4	UTSW	9	37,313,206 (GRCm39)	start gained	probably benign
R9375:Robo4	UTSW	9	37,316,158 (GRCm39)	missense	probably damaging	1.00
R9621:Robo4	UTSW	9	37,317,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCTGTAAAAGGTCCCAAGCCTG -3'
(R):5'- TGGTGGAGCCCAACTCACAAAG -3'

Sequencing Primer
(F):5'- ATTAGGGCTGCCATGAGC -3'
(R):5'- TTATGGAGAGCCAGAGTTCCAC -3'

Posted On

2013-08-06