Incidental Mutation 'R7931:Nebl'
ID643574
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7931 (G1)
Quality Score999
Status Validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 17376622 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000177966]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124270
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177966
SMART Domains Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 5 35 2.23e-4 SMART
NEBU 36 66 3.28e-2 SMART
NEBU 67 97 6.6e-7 SMART
NEBU 98 120 2e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,206,715 probably null Het
Aire G A 10: 78,030,296 A536V probably damaging Het
Aox4 A G 1: 58,255,486 I951M probably benign Het
Ash1l G T 3: 89,043,541 C2190F probably damaging Het
C1s1 C T 6: 124,533,400 V363M probably damaging Het
Col7a1 C A 9: 108,980,522 probably benign Het
Coq10b A G 1: 55,052,993 probably benign Het
Diaph3 A T 14: 87,115,020 D48E possibly damaging Het
Dnajc13 A G 9: 104,218,564 V559A probably benign Het
Dzank1 T C 2: 144,481,694 I610V probably benign Het
F7 A G 8: 13,035,209 I412V probably benign Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm13212 G A 4: 145,622,556 D188N possibly damaging Het
Gria1 A G 11: 57,310,525 probably benign Het
Hoxa13 G GCA 6: 52,260,637 probably null Het
Igkv4-70 C A 6: 69,267,991 R82L probably damaging Het
Lnp1 T A 16: 56,927,918 R4* probably null Het
Lrrc3b T C 14: 15,358,018 N196S probably benign Het
Mlxip A G 5: 123,450,495 D816G probably damaging Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Myom3 A T 4: 135,789,636 H839L probably benign Het
Ninj1 T C 13: 49,193,956 I99T probably damaging Het
Nvl C T 1: 181,109,155 probably benign Het
Olfr1249 T A 2: 89,630,104 I265F possibly damaging Het
Olfr167 A G 16: 19,515,508 S43P possibly damaging Het
Olfr738 A C 14: 50,414,329 M262L probably damaging Het
Olfr972 A T 9: 39,873,850 T192S possibly damaging Het
Otop1 A G 5: 38,288,020 H174R probably damaging Het
Pcdhb16 A G 18: 37,478,457 N157D possibly damaging Het
Prss44 A C 9: 110,814,678 Q130P probably damaging Het
Ptprh C A 7: 4,571,988 S344I probably benign Het
Rps6kl1 T C 12: 85,149,792 I33V possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn1a T C 2: 66,317,812 S110G probably damaging Het
Sdk2 C A 11: 113,893,441 K157N possibly damaging Het
Serpina1d A T 12: 103,767,556 V163D probably damaging Het
Serpina3g T C 12: 104,239,169 S56P probably benign Het
Slc4a4 T C 5: 89,170,781 L636P probably benign Het
Slc6a1 T C 6: 114,311,902 F474S probably benign Het
Slco6d1 A G 1: 98,428,416 D235G probably damaging Het
Srgn A T 10: 62,494,984 M114K possibly damaging Het
Syne3 A T 12: 104,963,232 V243E probably damaging Het
Tbc1d5 T C 17: 50,799,864 probably benign Het
Tcf19 A G 17: 35,514,907 F118L probably damaging Het
Tln2 A T 9: 67,258,460 probably null Het
Tnxb A G 17: 34,688,698 T1239A probably damaging Het
Traip A G 9: 107,971,042 I453M probably benign Het
Usp5 T C 6: 124,824,446 probably benign Het
Vmn1r157 C T 7: 22,761,785 A30V probably damaging Het
Vmn1r233 G A 17: 20,993,863 A275V probably benign Het
Vps13d G A 4: 145,096,284 R2976* probably null Het
Wdr75 T C 1: 45,819,635 F655L probably benign Het
Wwp1 A G 4: 19,650,114 probably null Het
Zc3h4 T C 7: 16,432,984 L747P unknown Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
BB008:Nebl UTSW 2 17376622 critical splice donor site probably null
BB018:Nebl UTSW 2 17376622 critical splice donor site probably null
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 splice site probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
R8007:Nebl UTSW 2 17370489 missense
R8048:Nebl UTSW 2 17424522 missense probably benign 0.12
R8118:Nebl UTSW 2 17379820 missense possibly damaging 0.48
R8317:Nebl UTSW 2 17350757 missense possibly damaging 0.71
R8349:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8360:Nebl UTSW 2 17460487 missense probably benign 0.04
R8392:Nebl UTSW 2 17452552 missense probably benign 0.36
R8449:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8537:Nebl UTSW 2 17350709 missense probably benign 0.02
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTCATGTTCAGTGAAGTACATCAG -3'
(R):5'- TGAAATTACATATGGCGTGGTCC -3'

Sequencing Primer
(F):5'- TGAGTCATTGCTTAAACAAACTAGAG -3'
(R):5'- AAATTACATATGGCGTGGTCCTTCTG -3'
Posted On2020-08-07