Mutagenetix > Incidental Mutations

Incidental Mutation 'R7931:Nebl'

643574

Institutional Source

Beutler Lab

Gene Symbol

Nebl

Ensembl Gene

ENSMUSG00000053702

Gene Name

nebulette

Synonyms

Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7931 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

17343909-17731464 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 17376622 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000177966]

Predicted Effect

probably benign
Transcript: ENSMUST00000028080

SMART Domains

Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
LIM	4	56	6.95e-14	SMART
NEBU	62	92	3.35e-8	SMART
NEBU	98	128	4.88e-10	SMART
NEBU	134	164	3.82e-3	SMART
SH3	213	270	2.12e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000124270

SMART Domains

Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	1.57e0	SMART
NEBU	280	310	9.67e-1	SMART
NEBU	315	345	6.25e-8	SMART
NEBU	351	381	5.97e-5	SMART
NEBU	387	418	2.56e-4	SMART
NEBU	425	455	8.91e-4	SMART
NEBU	462	492	4.92e-6	SMART
NEBU	499	529	2.33e-7	SMART
NEBU	536	566	1.84e-5	SMART
NEBU	571	601	2.23e-4	SMART
NEBU	602	632	1.24e-2	SMART
NEBU	664	694	6.6e-7	SMART
NEBU	695	725	6.86e-5	SMART
NEBU	726	756	2.03e-7	SMART
NEBU	761	791	1.74e-6	SMART
NEBU	797	827	3.82e-3	SMART
SH3	957	1014	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124611

SMART Domains

Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	3	33	4.88e-10	SMART
NEBU	39	69	3.82e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177966

SMART Domains

Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	5	35	2.23e-4	SMART
NEBU	36	66	3.28e-2	SMART
NEBU	67	97	6.6e-7	SMART
NEBU	98	120	2e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp2	A	T	2: 91,206,715		probably null	Het
Aire	G	A	10: 78,030,296	A536V	probably damaging	Het
Aox4	A	G	1: 58,255,486	I951M	probably benign	Het
Ash1l	G	T	3: 89,043,541	C2190F	probably damaging	Het
C1s1	C	T	6: 124,533,400	V363M	probably damaging	Het
Col7a1	C	A	9: 108,980,522		probably benign	Het
Coq10b	A	G	1: 55,052,993		probably benign	Het
Diaph3	A	T	14: 87,115,020	D48E	possibly damaging	Het
Dnajc13	A	G	9: 104,218,564	V559A	probably benign	Het
Dzank1	T	C	2: 144,481,694	I610V	probably benign	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Flt1	A	G	5: 147,588,572	S919P	probably damaging	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm13212	G	A	4: 145,622,556	D188N	possibly damaging	Het
Gria1	A	G	11: 57,310,525		probably benign	Het
Hoxa13	G	GCA	6: 52,260,637		probably null	Het
Igkv4-70	C	A	6: 69,267,991	R82L	probably damaging	Het
Lnp1	T	A	16: 56,927,918	R4*	probably null	Het
Lrrc3b	T	C	14: 15,358,018	N196S	probably benign	Het
Mlxip	A	G	5: 123,450,495	D816G	probably damaging	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Myom3	A	T	4: 135,789,636	H839L	probably benign	Het
Ninj1	T	C	13: 49,193,956	I99T	probably damaging	Het
Nvl	C	T	1: 181,109,155		probably benign	Het
Olfr1249	T	A	2: 89,630,104	I265F	possibly damaging	Het
Olfr167	A	G	16: 19,515,508	S43P	possibly damaging	Het
Olfr738	A	C	14: 50,414,329	M262L	probably damaging	Het
Olfr972	A	T	9: 39,873,850	T192S	possibly damaging	Het
Otop1	A	G	5: 38,288,020	H174R	probably damaging	Het
Pcdhb16	A	G	18: 37,478,457	N157D	possibly damaging	Het
Prss44	A	C	9: 110,814,678	Q130P	probably damaging	Het
Ptprh	C	A	7: 4,571,988	S344I	probably benign	Het
Rps6kl1	T	C	12: 85,149,792	I33V	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Scn1a	T	C	2: 66,317,812	S110G	probably damaging	Het
Sdk2	C	A	11: 113,893,441	K157N	possibly damaging	Het
Serpina1d	A	T	12: 103,767,556	V163D	probably damaging	Het
Serpina3g	T	C	12: 104,239,169	S56P	probably benign	Het
Slc4a4	T	C	5: 89,170,781	L636P	probably benign	Het
Slc6a1	T	C	6: 114,311,902	F474S	probably benign	Het
Slco6d1	A	G	1: 98,428,416	D235G	probably damaging	Het
Srgn	A	T	10: 62,494,984	M114K	possibly damaging	Het
Syne3	A	T	12: 104,963,232	V243E	probably damaging	Het
Tbc1d5	T	C	17: 50,799,864		probably benign	Het
Tcf19	A	G	17: 35,514,907	F118L	probably damaging	Het
Tln2	A	T	9: 67,258,460		probably null	Het
Tnxb	A	G	17: 34,688,698	T1239A	probably damaging	Het
Traip	A	G	9: 107,971,042	I453M	probably benign	Het
Usp5	T	C	6: 124,824,446		probably benign	Het
Vmn1r157	C	T	7: 22,761,785	A30V	probably damaging	Het
Vmn1r233	G	A	17: 20,993,863	A275V	probably benign	Het
Vps13d	G	A	4: 145,096,284	R2976*	probably null	Het
Wdr75	T	C	1: 45,819,635	F655L	probably benign	Het
Wwp1	A	G	4: 19,650,114		probably null	Het
Zc3h4	T	C	7: 16,432,984	L747P	unknown	Het

Other mutations in Nebl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02146:Nebl	APN	2	17348868	missense	probably damaging	0.99
IGL02732:Nebl	APN	2	17452484	splice site	probably benign
IGL03241:Nebl	APN	2	17393164	critical splice donor site	probably null
IGL03334:Nebl	APN	2	17413711	missense	probably damaging	0.98
BB008:Nebl	UTSW	2	17376622	critical splice donor site	probably null
BB018:Nebl	UTSW	2	17376622	critical splice donor site	probably null
R0068:Nebl	UTSW	2	17434971	nonsense	probably null
R0127:Nebl	UTSW	2	17392983	missense	probably benign	0.31
R0128:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17390926	start gained	probably benign
R0537:Nebl	UTSW	2	17404215	missense	possibly damaging	0.62
R0743:Nebl	UTSW	2	17411118	missense	probably benign
R0884:Nebl	UTSW	2	17411118	missense	probably benign
R1364:Nebl	UTSW	2	17393037	unclassified	probably benign
R1638:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R1711:Nebl	UTSW	2	17388754	missense	probably damaging	0.96
R1933:Nebl	UTSW	2	17375292	missense	probably damaging	0.97
R1990:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1991:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1992:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R2062:Nebl	UTSW	2	17397121	missense	probably benign	0.39
R2183:Nebl	UTSW	2	17404216	missense	probably damaging	0.99
R2325:Nebl	UTSW	2	17393016	missense	possibly damaging	0.79
R2679:Nebl	UTSW	2	17424591	missense	probably benign	0.03
R2877:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R2878:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R3079:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3080:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3878:Nebl	UTSW	2	17393252	missense	possibly damaging	0.83
R3947:Nebl	UTSW	2	17378106	critical splice donor site	probably null
R4983:Nebl	UTSW	2	17375271	missense	possibly damaging	0.80
R5006:Nebl	UTSW	2	17388771	splice site	probably null
R5256:Nebl	UTSW	2	17433975	missense	probably benign	0.37
R5491:Nebl	UTSW	2	17434972	nonsense	probably null
R5533:Nebl	UTSW	2	17393268	nonsense	probably null
R5597:Nebl	UTSW	2	17378167	missense	probably benign
R5658:Nebl	UTSW	2	17348852	missense	probably damaging	1.00
R5933:Nebl	UTSW	2	17404187	missense	probably benign
R6056:Nebl	UTSW	2	17450234	missense	probably benign	0.13
R6161:Nebl	UTSW	2	17730830	missense	probably benign	0.26
R6646:Nebl	UTSW	2	17376685	missense	probably damaging	1.00
R6784:Nebl	UTSW	2	17434914	nonsense	probably null
R6935:Nebl	UTSW	2	17348826	missense	probably damaging	1.00
R7196:Nebl	UTSW	2	17452518	missense	probably damaging	1.00
R7671:Nebl	UTSW	2	17390916	nonsense	probably null
R7728:Nebl	UTSW	2	17370514	missense
R8007:Nebl	UTSW	2	17370489	missense
R8048:Nebl	UTSW	2	17424522	missense	probably benign	0.12
R8118:Nebl	UTSW	2	17379820	missense	possibly damaging	0.48
R8317:Nebl	UTSW	2	17350757	missense	possibly damaging	0.71
R8349:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
R8360:Nebl	UTSW	2	17460487	missense	probably benign	0.04
R8392:Nebl	UTSW	2	17452552	missense	probably benign	0.36
R8449:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
R8537:Nebl	UTSW	2	17350709	missense	probably benign	0.02
X0012:Nebl	UTSW	2	17443794	missense	probably benign	0.16
X0025:Nebl	UTSW	2	17404267	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACTCATGTTCAGTGAAGTACATCAG -3'
(R):5'- TGAAATTACATATGGCGTGGTCC -3'

Sequencing Primer
(F):5'- TGAGTCATTGCTTAAACAAACTAGAG -3'
(R):5'- AAATTACATATGGCGTGGTCCTTCTG -3'

Posted On

2020-08-07