Mutagenetix > Incidental Mutations

Incidental Mutation 'R7931:Slc4a4'

643586

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7931 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89170781 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 636 (L636P)

Ref Sequence

ENSEMBL: ENSMUSP00000108844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]

Predicted Effect

probably benign
Transcript: ENSMUST00000113218
AA Change: L636P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: L636P

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130041
AA Change: L601P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: L601P

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148750
AA Change: L645P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: L645P

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156238
AA Change: L645P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: L645P

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp2	A	T	2: 91,206,715		probably null	Het
Aire	G	A	10: 78,030,296	A536V	probably damaging	Het
Aox4	A	G	1: 58,255,486	I951M	probably benign	Het
Ash1l	G	T	3: 89,043,541	C2190F	probably damaging	Het
C1s1	C	T	6: 124,533,400	V363M	probably damaging	Het
Col7a1	C	A	9: 108,980,522		probably benign	Het
Coq10b	A	G	1: 55,052,993		probably benign	Het
Diaph3	A	T	14: 87,115,020	D48E	possibly damaging	Het
Dnajc13	A	G	9: 104,218,564	V559A	probably benign	Het
Dzank1	T	C	2: 144,481,694	I610V	probably benign	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Flt1	A	G	5: 147,588,572	S919P	probably damaging	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm13212	G	A	4: 145,622,556	D188N	possibly damaging	Het
Gria1	A	G	11: 57,310,525		probably benign	Het
Hoxa13	G	GCA	6: 52,260,637		probably null	Het
Igkv4-70	C	A	6: 69,267,991	R82L	probably damaging	Het
Lnp1	T	A	16: 56,927,918	R4*	probably null	Het
Lrrc3b	T	C	14: 15,358,018	N196S	probably benign	Het
Mlxip	A	G	5: 123,450,495	D816G	probably damaging	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Myom3	A	T	4: 135,789,636	H839L	probably benign	Het
Nebl	C	T	2: 17,376,622		probably null	Het
Ninj1	T	C	13: 49,193,956	I99T	probably damaging	Het
Nvl	C	T	1: 181,109,155		probably benign	Het
Olfr1249	T	A	2: 89,630,104	I265F	possibly damaging	Het
Olfr167	A	G	16: 19,515,508	S43P	possibly damaging	Het
Olfr738	A	C	14: 50,414,329	M262L	probably damaging	Het
Olfr972	A	T	9: 39,873,850	T192S	possibly damaging	Het
Otop1	A	G	5: 38,288,020	H174R	probably damaging	Het
Pcdhb16	A	G	18: 37,478,457	N157D	possibly damaging	Het
Prss44	A	C	9: 110,814,678	Q130P	probably damaging	Het
Ptprh	C	A	7: 4,571,988	S344I	probably benign	Het
Rps6kl1	T	C	12: 85,149,792	I33V	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Scn1a	T	C	2: 66,317,812	S110G	probably damaging	Het
Sdk2	C	A	11: 113,893,441	K157N	possibly damaging	Het
Serpina1d	A	T	12: 103,767,556	V163D	probably damaging	Het
Serpina3g	T	C	12: 104,239,169	S56P	probably benign	Het
Slc6a1	T	C	6: 114,311,902	F474S	probably benign	Het
Slco6d1	A	G	1: 98,428,416	D235G	probably damaging	Het
Srgn	A	T	10: 62,494,984	M114K	possibly damaging	Het
Syne3	A	T	12: 104,963,232	V243E	probably damaging	Het
Tbc1d5	T	C	17: 50,799,864		probably benign	Het
Tcf19	A	G	17: 35,514,907	F118L	probably damaging	Het
Tln2	A	T	9: 67,258,460		probably null	Het
Tnxb	A	G	17: 34,688,698	T1239A	probably damaging	Het
Traip	A	G	9: 107,971,042	I453M	probably benign	Het
Usp5	T	C	6: 124,824,446		probably benign	Het
Vmn1r157	C	T	7: 22,761,785	A30V	probably damaging	Het
Vmn1r233	G	A	17: 20,993,863	A275V	probably benign	Het
Vps13d	G	A	4: 145,096,284	R2976*	probably null	Het
Wdr75	T	C	1: 45,819,635	F655L	probably benign	Het
Wwp1	A	G	4: 19,650,114		probably null	Het
Zc3h4	T	C	7: 16,432,984	L747P	unknown	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATATCTGCCATACAATCCTGCTG -3'
(R):5'- CGCTAACTTAAAGCTGACATTCTG -3'

Sequencing Primer
(F):5'- AGAGCATGCTTACAATACTCAGG -3'
(R):5'- AAAGCTGACATTCTGTTTGTTCC -3'

Posted On

2020-08-07