Incidental Mutation 'R7931:Serpina1d'
ID643607
Institutional Source Beutler Lab
Gene Symbol Serpina1d
Ensembl Gene ENSMUSG00000071177
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1D
SynonymsSpi1-4, PI4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7931 (G1)
Quality Score999
Status Not validated
Chromosome12
Chromosomal Location103763594-103773592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103767556 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 163 (V163D)
Ref Sequence ENSEMBL: ENSMUSP00000077909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078869] [ENSMUST00000164454]
Predicted Effect probably damaging
Transcript: ENSMUST00000078869
AA Change: V163D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077909
Gene: ENSMUSG00000071177
AA Change: V163D

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
SERPIN 53 410 3.17e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164454
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,206,715 probably null Het
Aire G A 10: 78,030,296 A536V probably damaging Het
Aox4 A G 1: 58,255,486 I951M probably benign Het
Ash1l G T 3: 89,043,541 C2190F probably damaging Het
C1s1 C T 6: 124,533,400 V363M probably damaging Het
Col7a1 C A 9: 108,980,522 probably benign Het
Coq10b A G 1: 55,052,993 probably benign Het
Diaph3 A T 14: 87,115,020 D48E possibly damaging Het
Dnajc13 A G 9: 104,218,564 V559A probably benign Het
Dzank1 T C 2: 144,481,694 I610V probably benign Het
F7 A G 8: 13,035,209 I412V probably benign Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm13212 G A 4: 145,622,556 D188N possibly damaging Het
Gria1 A G 11: 57,310,525 probably benign Het
Hoxa13 G GCA 6: 52,260,637 probably null Het
Igkv4-70 C A 6: 69,267,991 R82L probably damaging Het
Lnp1 T A 16: 56,927,918 R4* probably null Het
Lrrc3b T C 14: 15,358,018 N196S probably benign Het
Mlxip A G 5: 123,450,495 D816G probably damaging Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Myom3 A T 4: 135,789,636 H839L probably benign Het
Nebl C T 2: 17,376,622 probably null Het
Ninj1 T C 13: 49,193,956 I99T probably damaging Het
Nvl C T 1: 181,109,155 probably benign Het
Olfr1249 T A 2: 89,630,104 I265F possibly damaging Het
Olfr167 A G 16: 19,515,508 S43P possibly damaging Het
Olfr738 A C 14: 50,414,329 M262L probably damaging Het
Olfr972 A T 9: 39,873,850 T192S possibly damaging Het
Otop1 A G 5: 38,288,020 H174R probably damaging Het
Pcdhb16 A G 18: 37,478,457 N157D possibly damaging Het
Prss44 A C 9: 110,814,678 Q130P probably damaging Het
Ptprh C A 7: 4,571,988 S344I probably benign Het
Rps6kl1 T C 12: 85,149,792 I33V possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn1a T C 2: 66,317,812 S110G probably damaging Het
Sdk2 C A 11: 113,893,441 K157N possibly damaging Het
Serpina3g T C 12: 104,239,169 S56P probably benign Het
Slc4a4 T C 5: 89,170,781 L636P probably benign Het
Slc6a1 T C 6: 114,311,902 F474S probably benign Het
Slco6d1 A G 1: 98,428,416 D235G probably damaging Het
Srgn A T 10: 62,494,984 M114K possibly damaging Het
Syne3 A T 12: 104,963,232 V243E probably damaging Het
Tbc1d5 T C 17: 50,799,864 probably benign Het
Tcf19 A G 17: 35,514,907 F118L probably damaging Het
Tln2 A T 9: 67,258,460 probably null Het
Tnxb A G 17: 34,688,698 T1239A probably damaging Het
Traip A G 9: 107,971,042 I453M probably benign Het
Usp5 T C 6: 124,824,446 probably benign Het
Vmn1r157 C T 7: 22,761,785 A30V probably damaging Het
Vmn1r233 G A 17: 20,993,863 A275V probably benign Het
Vps13d G A 4: 145,096,284 R2976* probably null Het
Wdr75 T C 1: 45,819,635 F655L probably benign Het
Wwp1 A G 4: 19,650,114 probably null Het
Zc3h4 T C 7: 16,432,984 L747P unknown Het
Other mutations in Serpina1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Serpina1d APN 12 103763734 missense probably benign 0.00
IGL02175:Serpina1d APN 12 103765696 splice site probably null
IGL02336:Serpina1d APN 12 103764796 nonsense probably null
IGL03260:Serpina1d APN 12 103763849 missense probably damaging 0.98
BB008:Serpina1d UTSW 12 103767556 missense probably damaging 0.99
BB018:Serpina1d UTSW 12 103767556 missense probably damaging 0.99
R0119:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0299:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0348:Serpina1d UTSW 12 103763775 missense probably benign 0.05
R0499:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R1086:Serpina1d UTSW 12 103763787 missense probably benign
R1864:Serpina1d UTSW 12 103767997 missense probably benign 0.21
R1883:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R1884:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R3731:Serpina1d UTSW 12 103767905 missense possibly damaging 0.63
R3973:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R3976:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R4227:Serpina1d UTSW 12 103767481 missense probably benign 0.03
R4783:Serpina1d UTSW 12 103767824 missense possibly damaging 0.87
R5672:Serpina1d UTSW 12 103763842 missense possibly damaging 0.69
R5764:Serpina1d UTSW 12 103765821 missense probably benign 0.00
R6244:Serpina1d UTSW 12 103764828 splice site probably null
R6314:Serpina1d UTSW 12 103764700 missense probably benign 0.39
R6548:Serpina1d UTSW 12 103767552 missense probably damaging 1.00
R6554:Serpina1d UTSW 12 103764803 missense probably benign 0.09
R6953:Serpina1d UTSW 12 103767730 missense probably benign 0.00
R7106:Serpina1d UTSW 12 103765721 missense probably benign 0.01
R7390:Serpina1d UTSW 12 103767778 missense possibly damaging 0.86
R8085:Serpina1d UTSW 12 103763828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTCAGAAACTGGTTCTCAAG -3'
(R):5'- CACACAAACATCGGAGGCTG -3'

Sequencing Primer
(F):5'- CTCAAGAATATGTATGGGTGTCTCC -3'
(R):5'- GGAGGCTGACATCCACAAGTC -3'
Posted On2020-08-07