Mutagenetix > Incidental Mutations

Incidental Mutation 'R7931:Olfr167'

643615

Institutional Source

Beutler Lab

Gene Symbol

Olfr167

Ensembl Gene

ENSMUSG00000045341

Gene Name

olfactory receptor 167

Synonyms

MOR272-1, GA_x54KRFPKG5P-15963726-15962788

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.335) question?

Stock #

R7931 (G1)

Quality Score

999

Status

Validated

Chromosome

Chromosomal Location

19509558-19522266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19515508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 43 (S43P)

Ref Sequence

ENSEMBL: ENSMUSP00000150102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]

AlphaFold

Q8VGJ5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054606
AA Change: S43P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: S43P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	306	4.8e-46	PFAM
Pfam:7TM_GPCR_Srsx	33	295	1.2e-6	PFAM
Pfam:7tm_1	40	289	1.8e-26	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214315
AA Change: S43P

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp2	A	T	2: 91,206,715		probably null	Het
Aire	G	A	10: 78,030,296	A536V	probably damaging	Het
Aox4	A	G	1: 58,255,486	I951M	probably benign	Het
Ash1l	G	T	3: 89,043,541	C2190F	probably damaging	Het
C1s1	C	T	6: 124,533,400	V363M	probably damaging	Het
Col7a1	C	A	9: 108,980,522		probably benign	Het
Coq10b	A	G	1: 55,052,993		probably benign	Het
Diaph3	A	T	14: 87,115,020	D48E	possibly damaging	Het
Dnajc13	A	G	9: 104,218,564	V559A	probably benign	Het
Dzank1	T	C	2: 144,481,694	I610V	probably benign	Het
F7	A	G	8: 13,035,209	I412V	probably benign	Het
Flt1	A	G	5: 147,588,572	S919P	probably damaging	Het
Gm10800	AAGAAAACTGAAAATCAT	A	2: 98,667,034		probably benign	Het
Gm13212	G	A	4: 145,622,556	D188N	possibly damaging	Het
Gria1	A	G	11: 57,310,525		probably benign	Het
Hoxa13	G	GCA	6: 52,260,637		probably null	Het
Igkv4-70	C	A	6: 69,267,991	R82L	probably damaging	Het
Lnp1	T	A	16: 56,927,918	R4*	probably null	Het
Lrrc3b	T	C	14: 15,358,018	N196S	probably benign	Het
Mlxip	A	G	5: 123,450,495	D816G	probably damaging	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Myom3	A	T	4: 135,789,636	H839L	probably benign	Het
Nebl	C	T	2: 17,376,622		probably null	Het
Ninj1	T	C	13: 49,193,956	I99T	probably damaging	Het
Nvl	C	T	1: 181,109,155		probably benign	Het
Olfr1249	T	A	2: 89,630,104	I265F	possibly damaging	Het
Olfr738	A	C	14: 50,414,329	M262L	probably damaging	Het
Olfr972	A	T	9: 39,873,850	T192S	possibly damaging	Het
Otop1	A	G	5: 38,288,020	H174R	probably damaging	Het
Pcdhb16	A	G	18: 37,478,457	N157D	possibly damaging	Het
Prss44	A	C	9: 110,814,678	Q130P	probably damaging	Het
Ptprh	C	A	7: 4,571,988	S344I	probably benign	Het
Rps6kl1	T	C	12: 85,149,792	I33V	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Scn1a	T	C	2: 66,317,812	S110G	probably damaging	Het
Sdk2	C	A	11: 113,893,441	K157N	possibly damaging	Het
Serpina1d	A	T	12: 103,767,556	V163D	probably damaging	Het
Serpina3g	T	C	12: 104,239,169	S56P	probably benign	Het
Slc4a4	T	C	5: 89,170,781	L636P	probably benign	Het
Slc6a1	T	C	6: 114,311,902	F474S	probably benign	Het
Slco6d1	A	G	1: 98,428,416	D235G	probably damaging	Het
Srgn	A	T	10: 62,494,984	M114K	possibly damaging	Het
Syne3	A	T	12: 104,963,232	V243E	probably damaging	Het
Tbc1d5	T	C	17: 50,799,864		probably benign	Het
Tcf19	A	G	17: 35,514,907	F118L	probably damaging	Het
Tln2	A	T	9: 67,258,460		probably null	Het
Tnxb	A	G	17: 34,688,698	T1239A	probably damaging	Het
Traip	A	G	9: 107,971,042	I453M	probably benign	Het
Usp5	T	C	6: 124,824,446		probably benign	Het
Vmn1r157	C	T	7: 22,761,785	A30V	probably damaging	Het
Vmn1r233	G	A	17: 20,993,863	A275V	probably benign	Het
Vps13d	G	A	4: 145,096,284	R2976*	probably null	Het
Wdr75	T	C	1: 45,819,635	F655L	probably benign	Het
Wwp1	A	G	4: 19,650,114		probably null	Het
Zc3h4	T	C	7: 16,432,984	L747P	unknown	Het

Other mutations in Olfr167

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01535:Olfr167	APN	16	19515478	missense	probably benign	0.01
IGL02115:Olfr167	APN	16	19515103	missense	probably damaging	1.00
IGL02562:Olfr167	APN	16	19514964	missense	possibly damaging	0.74
BB008:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
BB018:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
R0366:Olfr167	UTSW	16	19514848	missense	probably benign	0.13
R0673:Olfr167	UTSW	16	19515396	missense	probably damaging	1.00
R1187:Olfr167	UTSW	16	19515046	missense	probably benign	0.01
R1237:Olfr167	UTSW	16	19515625	missense	probably benign	0.01
R1975:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1977:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1997:Olfr167	UTSW	16	19515042	missense	probably damaging	1.00
R2225:Olfr167	UTSW	16	19515246	missense	probably benign	0.05
R2226:Olfr167	UTSW	16	19515246	missense	probably benign	0.05
R4078:Olfr167	UTSW	16	19515232	missense	possibly damaging	0.76
R5019:Olfr167	UTSW	16	19515535	missense	probably damaging	0.99
R5071:Olfr167	UTSW	16	19515027	missense	probably benign	0.00
R5278:Olfr167	UTSW	16	19515378	nonsense	probably null
R5415:Olfr167	UTSW	16	19515246	missense	possibly damaging	0.94
R5744:Olfr167	UTSW	16	19515336	missense	probably benign	0.00
R5991:Olfr167	UTSW	16	19514757	missense	probably damaging	0.99
R6151:Olfr167	UTSW	16	19515531	missense	probably damaging	1.00
R6540:Olfr167	UTSW	16	19514821	missense	probably benign
R7014:Olfr167	UTSW	16	19515456	missense	probably benign	0.20
R7145:Olfr167	UTSW	16	19514899	missense	probably damaging	0.99
R7535:Olfr167	UTSW	16	19514794	missense	probably damaging	1.00
R7677:Olfr167	UTSW	16	19514928	missense	probably benign	0.42
R7715:Olfr167	UTSW	16	19514730	missense	probably benign	0.00
R8137:Olfr167	UTSW	16	19515096	missense	possibly damaging	0.89
R8671:Olfr167	UTSW	16	19515054	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- AACAAAAGGGTTTCTGCACC -3'
(R):5'- GCAGTTATGATTATTCTCAGTCTGG -3'

Sequencing Primer
(F):5'- GGTTTCTGCACCCCCAAAAGTC -3'
(R):5'- CTCAGTCTGGTGAAAATCATGAATTG -3'

Posted On

2020-08-07