Incidental Mutation 'R0056:Snapc1'
ID64362
Institutional Source Beutler Lab
Gene Symbol Snapc1
Ensembl Gene ENSMUSG00000021113
Gene Namesmall nuclear RNA activating complex, polypeptide 1
Synonyms2700033G17Rik
MMRRC Submission 038350-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0056 (G1)
Quality Score115
Status Not validated
Chromosome12
Chromosomal Location73964481-73988966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73975032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 81 (R81C)
Ref Sequence ENSEMBL: ENSMUSP00000152248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556]
Predicted Effect probably damaging
Transcript: ENSMUST00000021532
AA Change: R302C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: R302C

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SNAPc_SNAP43 26 210 4.5e-65 PFAM
low complexity region 261 273 N/A INTRINSIC
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220882
AA Change: R81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000220909
AA Change: R48C
Predicted Effect probably benign
Transcript: ENSMUST00000221556
Meta Mutation Damage Score 0.2723 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 A T 6: 118,405,229 D449E probably benign Het
Etv3 T C 3: 87,535,828 Y240H possibly damaging Het
Fscb T G 12: 64,474,247 R148S possibly damaging Het
Mapk6 A G 9: 75,388,816 Y467H possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mogat1 T G 1: 78,523,770 M157R probably damaging Het
Pold2 T A 11: 5,872,338 S444C possibly damaging Het
Robo4 G A 9: 37,404,477 R342Q probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Stk10 T A 11: 32,617,851 N884K possibly damaging Het
Tex15 A G 8: 33,582,027 H2534R probably benign Het
Ticam2 G T 18: 46,560,334 Q229K possibly damaging Het
Other mutations in Snapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Snapc1 APN 12 73968374 splice site probably null
IGL00529:Snapc1 APN 12 73964655 missense probably benign 0.00
IGL00676:Snapc1 APN 12 73971913 missense probably damaging 1.00
IGL01373:Snapc1 APN 12 73964680 missense probably benign 0.00
IGL02060:Snapc1 APN 12 73968036 missense probably damaging 1.00
IGL02309:Snapc1 APN 12 73968027 missense probably damaging 1.00
IGL02653:Snapc1 APN 12 73982487 missense probably benign 0.00
IGL02686:Snapc1 APN 12 73964596 intron probably benign
IGL03160:Snapc1 APN 12 73970204 missense probably damaging 1.00
PIT4362001:Snapc1 UTSW 12 73982495 missense probably damaging 0.98
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0113:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0152:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0153:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0244:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0245:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0316:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0318:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0352:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0646:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0841:Snapc1 UTSW 12 73975006 splice site probably benign
R2188:Snapc1 UTSW 12 73970227 missense probably damaging 1.00
R2483:Snapc1 UTSW 12 73964643 missense probably benign 0.02
R4165:Snapc1 UTSW 12 73982580 critical splice donor site probably null
R4169:Snapc1 UTSW 12 73982491 missense probably benign 0.00
R4549:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4550:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4658:Snapc1 UTSW 12 73983868 missense possibly damaging 0.75
R6976:Snapc1 UTSW 12 73970200 missense probably damaging 1.00
R7432:Snapc1 UTSW 12 73968294 missense probably benign 0.01
R7488:Snapc1 UTSW 12 73982511 missense probably benign 0.39
R8507:Snapc1 UTSW 12 73964732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAATCTGGCGGTACAGTTACG -3'
(R):5'- AGGGTCTCTTTCAGCAACAAGAGC -3'

Sequencing Primer
(F):5'- GCTCTGTCCTCAGACCATTT -3'
(R):5'- taccccccaaccaaccc -3'
Posted On2013-08-06