Mutagenetix > Incidental Mutations

Incidental Mutation 'R0056:Snapc1'

64362

Institutional Source

Beutler Lab

Gene Symbol

Snapc1

Ensembl Gene

ENSMUSG00000021113

Gene Name

small nuclear RNA activating complex, polypeptide 1

Synonyms

2700033G17Rik

MMRRC Submission

038350-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0056 (G1)

Quality Score

115

Status

Not validated

Chromosome

Chromosomal Location

73964481-73988966 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 73975032 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 81 (R81C)

Ref Sequence

ENSEMBL: ENSMUSP00000152248 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021532
AA Change: R302C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: R302C

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
Pfam:SNAPc_SNAP43	26	210	4.5e-65	PFAM
low complexity region	261	273	N/A	INTRINSIC
low complexity region	307	316	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220882
AA Change: R81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000220909
AA Change: R48C

Predicted Effect

probably benign
Transcript: ENSMUST00000221556

Meta Mutation Damage Score

0.2723

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bms1	A	T	6: 118,405,229	D449E	probably benign	Het
Etv3	T	C	3: 87,535,828	Y240H	possibly damaging	Het
Fscb	T	G	12: 64,474,247	R148S	possibly damaging	Het
Mapk6	A	G	9: 75,388,816	Y467H	possibly damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mogat1	T	G	1: 78,523,770	M157R	probably damaging	Het
Pold2	T	A	11: 5,872,338	S444C	possibly damaging	Het
Robo4	G	A	9: 37,404,477	R342Q	probably benign	Het
Satb1	T	A	17: 51,740,203	I695F	probably damaging	Het
Stk10	T	A	11: 32,617,851	N884K	possibly damaging	Het
Tex15	A	G	8: 33,582,027	H2534R	probably benign	Het
Ticam2	G	T	18: 46,560,334	Q229K	possibly damaging	Het

Other mutations in Snapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Snapc1	APN	12	73968374	splice site	probably null
IGL00529:Snapc1	APN	12	73964655	missense	probably benign	0.00
IGL00676:Snapc1	APN	12	73971913	missense	probably damaging	1.00
IGL01373:Snapc1	APN	12	73964680	missense	probably benign	0.00
IGL02060:Snapc1	APN	12	73968036	missense	probably damaging	1.00
IGL02309:Snapc1	APN	12	73968027	missense	probably damaging	1.00
IGL02653:Snapc1	APN	12	73982487	missense	probably benign	0.00
IGL02686:Snapc1	APN	12	73964596	intron	probably benign
IGL03160:Snapc1	APN	12	73970204	missense	probably damaging	1.00
PIT4362001:Snapc1	UTSW	12	73982495	missense	probably damaging	0.98
R0057:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0057:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0113:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0152:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0153:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0244:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0245:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0316:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0318:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0352:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0646:Snapc1	UTSW	12	73975032	missense	probably damaging	1.00
R0841:Snapc1	UTSW	12	73975006	splice site	probably benign
R2188:Snapc1	UTSW	12	73970227	missense	probably damaging	1.00
R2483:Snapc1	UTSW	12	73964643	missense	probably benign	0.02
R4165:Snapc1	UTSW	12	73982580	critical splice donor site	probably null
R4169:Snapc1	UTSW	12	73982491	missense	probably benign	0.00
R4549:Snapc1	UTSW	12	73970279	missense	probably damaging	0.97
R4550:Snapc1	UTSW	12	73970279	missense	probably damaging	0.97
R4658:Snapc1	UTSW	12	73983868	missense	possibly damaging	0.75
R6976:Snapc1	UTSW	12	73970200	missense	probably damaging	1.00
R7432:Snapc1	UTSW	12	73968294	missense	probably benign	0.01
R7488:Snapc1	UTSW	12	73982511	missense	probably benign	0.39
R8507:Snapc1	UTSW	12	73964732	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGAATCTGGCGGTACAGTTACG -3'
(R):5'- AGGGTCTCTTTCAGCAACAAGAGC -3'

Sequencing Primer
(F):5'- GCTCTGTCCTCAGACCATTT -3'
(R):5'- taccccccaaccaaccc -3'

Posted On

2013-08-06