Incidental Mutation 'R7932:Olfr419'
ID643622
Institutional Source Beutler Lab
Gene Symbol Olfr419
Ensembl Gene ENSMUSG00000050788
Gene Nameolfactory receptor 419
SynonymsMOR267-6, GA_x6K02T2P20D-20891507-20892448
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7932 (G1)
Quality Score999
Status Not validated
Chromosome1
Chromosomal Location174248514-174252061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174250694 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 78 (I78V)
Ref Sequence ENSEMBL: ENSMUSP00000149512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]
Predicted Effect probably benign
Transcript: ENSMUST00000027817
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061990
AA Change: I78V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788
AA Change: I78V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-53 PFAM
Pfam:7tm_1 41 290 3.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214725
AA Change: I78V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,573,180 R666G unknown Het
Adam21 T A 12: 81,560,164 N275Y probably damaging Het
Adam33 G A 2: 131,063,697 probably benign Het
Arhgap24 A T 5: 102,845,969 probably benign Het
Arhgef1 C T 7: 24,919,710 L459F probably damaging Het
Bbx A T 16: 50,210,443 probably null Het
Blk C T 14: 63,373,559 G445S possibly damaging Het
Brca1 T C 11: 101,540,017 E33G possibly damaging Het
Cacna1s T G 1: 136,084,359 L513R probably damaging Het
Cnn3 T A 3: 121,451,429 M98K probably benign Het
Cttnbp2 T A 6: 18,427,533 L716F probably damaging Het
Dlgap1 A T 17: 70,516,238 R73W probably damaging Het
Dnajc4 A G 19: 6,988,270 L182P probably damaging Het
Dock2 T C 11: 34,267,998 M1191V probably benign Het
Fam13a C T 6: 58,983,888 probably null Het
Fbn2 C T 18: 58,020,483 G2569E possibly damaging Het
Fes T C 7: 80,379,872 I623V probably damaging Het
Fyco1 A C 9: 123,828,990 L707R possibly damaging Het
Gadd45b T A 10: 80,930,335 V7E possibly damaging Het
Gm12169 C A 11: 46,535,539 P158T probably benign Het
Gm19410 T A 8: 35,795,599 C897S probably damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Hk1 A G 10: 62,315,520 L31P probably damaging Het
Hoxa4 T G 6: 52,190,417 K261N probably damaging Het
Hrh4 T A 18: 13,015,812 L77* probably null Het
Igf1r A T 7: 68,212,054 I1121F possibly damaging Het
Igkv16-104 A T 6: 68,425,794 I24L probably benign Het
Itk A T 11: 46,340,692 W346R probably benign Het
Kdm2a A G 19: 4,319,156 S1144P probably damaging Het
Krt86 A T 15: 101,476,592 S289C probably damaging Het
Lonrf1 T C 8: 36,222,916 I663V probably benign Het
Lrp2 T G 2: 69,426,027 I4590L probably benign Het
Lrrc8d C T 5: 105,813,025 R434C probably damaging Het
Maneal T C 4: 124,861,845 Y108C probably damaging Het
Myh8 G A 11: 67,294,604 V894I probably benign Het
Ncam2 T G 16: 81,615,820 L732R probably damaging Het
Nsun4 A T 4: 116,044,800 D156E probably damaging Het
Olfr111 T C 17: 37,530,184 I69T probably benign Het
Olfr136 A T 17: 38,335,255 I33L probably benign Het
Olfr1459 A T 19: 13,145,981 M226K probably benign Het
Olfr382 A C 11: 73,517,157 L14R probably damaging Het
Olfr798 C A 10: 129,625,225 V279F probably damaging Het
P2rx7 G A 5: 122,644,182 V37I probably benign Het
Pcdh15 A G 10: 74,645,527 R235G probably benign Het
Pcdhga1 T C 18: 37,663,460 S506P probably damaging Het
Pira2 A T 7: 3,842,436 probably null Het
Plch1 A G 3: 63,701,981 V935A probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prpf8 A G 11: 75,492,597 D607G possibly damaging Het
Ptdss1 T C 13: 66,966,432 W215R probably damaging Het
Ptpn9 C A 9: 57,036,616 P258Q possibly damaging Het
Rfpl4b A G 10: 38,821,350 V85A possibly damaging Het
Sacs C A 14: 61,204,878 Q1458K probably damaging Het
Scfd2 A T 5: 74,531,550 S24T probably benign Het
Siae A G 9: 37,633,684 D325G probably benign Het
Slc22a23 C A 13: 34,182,977 A683S probably damaging Het
Slc44a3 A T 3: 121,512,360 I244N possibly damaging Het
Srrm2 T A 17: 23,818,527 S1382T probably benign Het
Tfap2c A G 2: 172,551,786 Y207C probably damaging Het
Tnc T C 4: 64,008,620 I890V probably benign Het
Trim30a A T 7: 104,429,338 I177N probably benign Het
Tshz2 T A 2: 169,886,331 M949K possibly damaging Het
Ttn T G 2: 76,725,186 T30492P probably damaging Het
Ubb C T 11: 62,552,785 Q214* probably null Het
Ulk2 A G 11: 61,808,090 S423P probably benign Het
Vmn1r237 C A 17: 21,314,463 D149E probably benign Het
Zbtb24 A G 10: 41,451,508 D130G probably benign Het
Zfp689 C A 7: 127,444,351 G369V probably damaging Het
Zg16 A G 7: 127,050,405 F128S probably damaging Het
Zmym1 T G 4: 127,050,785 N203T possibly damaging Het
Other mutations in Olfr419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Olfr419 APN 1 174250526 missense probably benign 0.41
IGL01765:Olfr419 APN 1 174250137 missense probably damaging 1.00
IGL02718:Olfr419 APN 1 174250707 nonsense probably null
IGL03208:Olfr419 APN 1 174250393 missense probably damaging 1.00
BB009:Olfr419 UTSW 1 174250694 missense probably benign 0.00
BB019:Olfr419 UTSW 1 174250694 missense probably benign 0.00
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1760:Olfr419 UTSW 1 174250360 missense probably damaging 0.99
R2138:Olfr419 UTSW 1 174250736 splice site probably null
R2139:Olfr419 UTSW 1 174250736 splice site probably null
R2869:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2869:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2873:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2874:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R3854:Olfr419 UTSW 1 174250150 missense probably damaging 1.00
R4614:Olfr419 UTSW 1 174250622 missense possibly damaging 0.93
R4858:Olfr419 UTSW 1 174250696 missense probably damaging 1.00
R5015:Olfr419 UTSW 1 174250882 missense possibly damaging 0.91
R5138:Olfr419 UTSW 1 174250829 missense probably damaging 0.97
R5296:Olfr419 UTSW 1 174250756 missense possibly damaging 0.75
R5369:Olfr419 UTSW 1 174250441 missense probably damaging 1.00
R6285:Olfr419 UTSW 1 174250829 missense possibly damaging 0.62
R7655:Olfr419 UTSW 1 174250218 missense probably damaging 1.00
R7656:Olfr419 UTSW 1 174250218 missense probably damaging 1.00
R7753:Olfr419 UTSW 1 174250670 missense probably benign 0.01
R8179:Olfr419 UTSW 1 174250564 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CATACGGCTGGCATAATGAAG -3'
(R):5'- GAGAGCAATGTGACCTGCTG -3'

Sequencing Primer
(F):5'- CTGGCATAATGAAGTGGGGCAC -3'
(R):5'- CTCTAGCTTCGGGGAGCTTCAG -3'
Posted On2020-08-07