Mutagenetix > Incidental Mutation

Incidental Mutation 'R7932:Lrp2'

643623

Institutional Source

Beutler Lab

Gene Symbol

Lrp2

Ensembl Gene

ENSMUSG00000027070

Gene Name

low density lipoprotein receptor-related protein 2

Synonyms

Gp330, D230004K18Rik, b2b1625.2Clo, Megalin

MMRRC Submission

045649-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7932 (G1)

Quality Score

999

Status

Not validated

Chromosome

Chromosomal Location

69424340-69586065 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 69426027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 4590 (I4590L)

Ref Sequence

ENSEMBL: ENSMUSP00000079752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080953]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080953
AA Change: I4590L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: I4590L

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
LDLa	27	64	5.63e-13	SMART
LDLa	66	105	2.25e-12	SMART
EGF	107	143	2.59e1	SMART
LDLa	107	144	9.29e-14	SMART
LDLa	146	181	6.18e-10	SMART
LDLa	182	219	1.08e-14	SMART
LDLa	221	258	1.05e-12	SMART
LDLa	264	302	1.66e-10	SMART
EGF	310	346	3.23e0	SMART
EGF	350	385	2.32e-1	SMART
LY	414	457	3.88e-3	SMART
LY	458	500	1.17e-6	SMART
LY	501	547	5.96e-13	SMART
LY	548	590	1.94e-12	SMART
LY	591	634	2.66e0	SMART
EGF	661	704	7.76e-3	SMART
LY	732	774	1.76e0	SMART
LY	775	817	3.64e-8	SMART
LY	818	860	1.11e-3	SMART
LY	861	903	2.11e-13	SMART
LY	905	946	9.33e-1	SMART
EGF	972	1013	1.73e0	SMART
LDLa	1024	1061	1.05e-12	SMART
LDLa	1065	1103	4.65e-14	SMART
LDLa	1109	1146	3.63e-16	SMART
LDLa	1149	1186	5.5e-16	SMART
LDLa	1187	1225	1.43e-14	SMART
LDLa	1230	1269	2.1e-12	SMART
LDLa	1271	1308	3.63e-16	SMART
LDLa	1312	1351	4.69e-10	SMART
EGF	1353	1390	9.7e-4	SMART
EGF_CA	1391	1430	6.54e-10	SMART
LY	1457	1501	1.43e-1	SMART
LY	1502	1544	2e-14	SMART
LY	1545	1590	3.03e-14	SMART
LY	1591	1633	5.48e-12	SMART
LY	1635	1677	1.18e-2	SMART
EGF	1704	1742	5.2e-4	SMART
LY	1771	1812	1.68e1	SMART
LY	1813	1856	1.91e-2	SMART
LY	1859	1911	1.88e-10	SMART
LY	1912	1954	7.69e-7	SMART
LY	1955	1994	3e1	SMART
EGF	2022	2060	1.18e-2	SMART
LY	2088	2135	1.14e1	SMART
LY	2136	2182	2.11e-4	SMART
LY	2183	2226	2.22e-12	SMART
LY	2227	2269	1.24e-10	SMART
EGF	2346	2384	2.07e1	SMART
LY	2459	2501	9.91e-10	SMART
LY	2503	2543	1.48e-8	SMART
LY	2544	2586	6.85e-13	SMART
LY	2587	2627	8.13e-1	SMART
EGF_like	2655	2694	3.5e1	SMART
LDLa	2700	2739	2.86e-14	SMART
LDLa	2741	2778	8.09e-14	SMART
LDLa	2780	2820	3.19e-12	SMART
LDLa	2822	2862	6.94e-13	SMART
LDLa	2864	2903	9.29e-14	SMART
LDLa	2907	2947	4.79e-16	SMART
LDLa	2949	2992	8.41e-12	SMART
LDLa	2994	3031	1.08e-14	SMART
LDLa	3033	3072	1.83e-12	SMART
LDLa	3076	3113	1.16e-14	SMART
EGF	3115	3153	8.57e-5	SMART
EGF_CA	3154	3194	3.56e-11	SMART
LY	3221	3263	9.77e-9	SMART
LY	3264	3306	1.22e-9	SMART
LY	3312	3358	5.44e-7	SMART
LY	3359	3401	1.83e-13	SMART
LY	3402	3443	1.41e-5	SMART
EGF	3470	3511	8.91e-3	SMART
LDLa	3513	3552	1.79e-15	SMART
LDLa	3554	3593	9.89e-9	SMART
LDLa	3595	3634	3.07e-14	SMART
LDLa	3636	3675	3.34e-15	SMART
LDLa	3679	3718	1.39e-12	SMART
LDLa	3720	3758	3.83e-15	SMART
LDLa	3760	3797	7.15e-15	SMART
LDLa	3799	3836	2.86e-14	SMART
LDLa	3843	3882	2.38e-11	SMART
LDLa	3884	3924	3.66e-12	SMART
LDLa	3929	3966	1.93e-11	SMART
EGF	3971	4008	6.3e-3	SMART
EGF_CA	4009	4050	1.36e-7	SMART
low complexity region	4072	4084	N/A	INTRINSIC
LY	4136	4178	6.2e-11	SMART
LY	4179	4222	4.32e-10	SMART
LY	4223	4266	3.78e-15	SMART
LY	4267	4306	4.53e1	SMART
EGF	4335	4367	3.46e0	SMART
EGF	4368	4413	1.53e-1	SMART
transmembrane domain	4425	4447	N/A	INTRINSIC
low complexity region	4454	4472	N/A	INTRINSIC
low complexity region	4616	4636	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,573,180	R666G	unknown	Het
Adam21	T	A	12: 81,560,164	N275Y	probably damaging	Het
Adam33	G	A	2: 131,063,697		probably benign	Het
Arhgap24	A	T	5: 102,845,969		probably benign	Het
Arhgef1	C	T	7: 24,919,710	L459F	probably damaging	Het
Bbx	A	T	16: 50,210,443		probably null	Het
Blk	C	T	14: 63,373,559	G445S	possibly damaging	Het
Brca1	T	C	11: 101,540,017	E33G	possibly damaging	Het
Cacna1s	T	G	1: 136,084,359	L513R	probably damaging	Het
Cnn3	T	A	3: 121,451,429	M98K	probably benign	Het
Cttnbp2	T	A	6: 18,427,533	L716F	probably damaging	Het
Dlgap1	A	T	17: 70,516,238	R73W	probably damaging	Het
Dnajc4	A	G	19: 6,988,270	L182P	probably damaging	Het
Dock2	T	C	11: 34,267,998	M1191V	probably benign	Het
Fam13a	C	T	6: 58,983,888		probably null	Het
Fbn2	C	T	18: 58,020,483	G2569E	possibly damaging	Het
Fes	T	C	7: 80,379,872	I623V	probably damaging	Het
Fyco1	A	C	9: 123,828,990	L707R	possibly damaging	Het
Gadd45b	T	A	10: 80,930,335	V7E	possibly damaging	Het
Gm12169	C	A	11: 46,535,539	P158T	probably benign	Het
Gm19410	T	A	8: 35,795,599	C897S	probably damaging	Het
Gm9573	TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT	TCCTGAGGCAGTGCTGGAT	17: 35,622,633		probably benign	Het
Hk1	A	G	10: 62,315,520	L31P	probably damaging	Het
Hoxa4	T	G	6: 52,190,417	K261N	probably damaging	Het
Hrh4	T	A	18: 13,015,812	L77*	probably null	Het
Igf1r	A	T	7: 68,212,054	I1121F	possibly damaging	Het
Igkv16-104	A	T	6: 68,425,794	I24L	probably benign	Het
Itk	A	T	11: 46,340,692	W346R	probably benign	Het
Kdm2a	A	G	19: 4,319,156	S1144P	probably damaging	Het
Krt86	A	T	15: 101,476,592	S289C	probably damaging	Het
Lonrf1	T	C	8: 36,222,916	I663V	probably benign	Het
Lrrc8d	C	T	5: 105,813,025	R434C	probably damaging	Het
Maneal	T	C	4: 124,861,845	Y108C	probably damaging	Het
Myh8	G	A	11: 67,294,604	V894I	probably benign	Het
Ncam2	T	G	16: 81,615,820	L732R	probably damaging	Het
Nsun4	A	T	4: 116,044,800	D156E	probably damaging	Het
Olfr111	T	C	17: 37,530,184	I69T	probably benign	Het
Olfr136	A	T	17: 38,335,255	I33L	probably benign	Het
Olfr1459	A	T	19: 13,145,981	M226K	probably benign	Het
Olfr382	A	C	11: 73,517,157	L14R	probably damaging	Het
Olfr419	T	C	1: 174,250,694	I78V	probably benign	Het
Olfr798	C	A	10: 129,625,225	V279F	probably damaging	Het
P2rx7	G	A	5: 122,644,182	V37I	probably benign	Het
Pcdh15	A	G	10: 74,645,527	R235G	probably benign	Het
Pcdhga1	T	C	18: 37,663,460	S506P	probably damaging	Het
Pira2	A	T	7: 3,842,436		probably null	Het
Plch1	A	G	3: 63,701,981	V935A	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Prpf8	A	G	11: 75,492,597	D607G	possibly damaging	Het
Ptdss1	T	C	13: 66,966,432	W215R	probably damaging	Het
Ptpn9	C	A	9: 57,036,616	P258Q	possibly damaging	Het
Rfpl4b	A	G	10: 38,821,350	V85A	possibly damaging	Het
Sacs	C	A	14: 61,204,878	Q1458K	probably damaging	Het
Scfd2	A	T	5: 74,531,550	S24T	probably benign	Het
Siae	A	G	9: 37,633,684	D325G	probably benign	Het
Slc22a23	C	A	13: 34,182,977	A683S	probably damaging	Het
Slc44a3	A	T	3: 121,512,360	I244N	possibly damaging	Het
Srrm2	T	A	17: 23,818,527	S1382T	probably benign	Het
Tfap2c	A	G	2: 172,551,786	Y207C	probably damaging	Het
Tnc	T	C	4: 64,008,620	I890V	probably benign	Het
Trim30a	A	T	7: 104,429,338	I177N	probably benign	Het
Tshz2	T	A	2: 169,886,331	M949K	possibly damaging	Het
Ttn	T	G	2: 76,725,186	T30492P	probably damaging	Het
Ubb	C	T	11: 62,552,785	Q214*	probably null	Het
Ulk2	A	G	11: 61,808,090	S423P	probably benign	Het
Vmn1r237	C	A	17: 21,314,463	D149E	probably benign	Het
Zbtb24	A	G	10: 41,451,508	D130G	probably benign	Het
Zfp689	C	A	7: 127,444,351	G369V	probably damaging	Het
Zg16	A	G	7: 127,050,405	F128S	probably damaging	Het
Zmym1	T	G	4: 127,050,785	N203T	possibly damaging	Het

Other mutations in Lrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Lrp2	APN	2	69507779	missense	probably damaging	1.00
IGL00594:Lrp2	APN	2	69486280	missense	probably benign	0.00
IGL00782:Lrp2	APN	2	69501645	missense	probably benign	0.14
IGL00821:Lrp2	APN	2	69459516	missense	probably damaging	1.00
IGL00897:Lrp2	APN	2	69521881	missense	possibly damaging	0.86
IGL01065:Lrp2	APN	2	69469436	missense	possibly damaging	0.94
IGL01087:Lrp2	APN	2	69524073	missense	probably damaging	1.00
IGL01095:Lrp2	APN	2	69492432	nonsense	probably null
IGL01131:Lrp2	APN	2	69499239	missense	probably damaging	1.00
IGL01350:Lrp2	APN	2	69510984	missense	probably damaging	0.96
IGL01352:Lrp2	APN	2	69503526	missense	possibly damaging	0.77
IGL01358:Lrp2	APN	2	69552470	splice site	probably benign
IGL01375:Lrp2	APN	2	69478566	splice site	probably benign
IGL01384:Lrp2	APN	2	69483502	missense	probably damaging	1.00
IGL01384:Lrp2	APN	2	69453812	missense	probably null	1.00
IGL01411:Lrp2	APN	2	69482267	missense	probably damaging	1.00
IGL01418:Lrp2	APN	2	69525286	missense	probably benign
IGL01444:Lrp2	APN	2	69443716	missense	possibly damaging	0.94
IGL01464:Lrp2	APN	2	69472439	missense	probably damaging	0.98
IGL01528:Lrp2	APN	2	69492460	missense	probably damaging	1.00
IGL01663:Lrp2	APN	2	69428706	missense	probably benign
IGL01761:Lrp2	APN	2	69481235	missense	possibly damaging	0.85
IGL01780:Lrp2	APN	2	69486184	missense	possibly damaging	0.66
IGL01994:Lrp2	APN	2	69483601	missense	probably benign	0.08
IGL02015:Lrp2	APN	2	69527578	missense	probably benign	0.00
IGL02104:Lrp2	APN	2	69510418	missense	probably damaging	1.00
IGL02132:Lrp2	APN	2	69537616	missense	probably benign	0.01
IGL02134:Lrp2	APN	2	69513379	critical splice acceptor site	probably null
IGL02197:Lrp2	APN	2	69466880	missense	probably benign	0.01
IGL02212:Lrp2	APN	2	69451264	missense	probably benign	0.00
IGL02240:Lrp2	APN	2	69535046	missense	probably benign
IGL02248:Lrp2	APN	2	69482808	missense	probably damaging	1.00
IGL02369:Lrp2	APN	2	69464636	missense	probably damaging	1.00
IGL02416:Lrp2	APN	2	69469633	missense	probably damaging	1.00
IGL02417:Lrp2	APN	2	69461305	missense	probably damaging	1.00
IGL02458:Lrp2	APN	2	69521773	missense	probably damaging	0.97
IGL02479:Lrp2	APN	2	69464801	splice site	probably benign
IGL02508:Lrp2	APN	2	69503430	missense	probably benign	0.04
IGL02751:Lrp2	APN	2	69533462	missense	possibly damaging	0.56
IGL02814:Lrp2	APN	2	69506736	missense	probably damaging	1.00
IGL02867:Lrp2	APN	2	69552450	missense	possibly damaging	0.67
IGL02889:Lrp2	APN	2	69552450	missense	possibly damaging	0.67
IGL02943:Lrp2	APN	2	69455510	missense	possibly damaging	0.86
IGL02948:Lrp2	APN	2	69487837	missense	probably damaging	1.00
IGL02960:Lrp2	APN	2	69455453	splice site	probably benign
IGL02990:Lrp2	APN	2	69441396	missense	possibly damaging	0.56
IGL03027:Lrp2	APN	2	69537553	missense	probably benign	0.43
IGL03038:Lrp2	APN	2	69475464	missense	probably damaging	0.99
IGL03064:Lrp2	APN	2	69483133	missense	probably damaging	0.98
IGL03107:Lrp2	APN	2	69454833	missense	probably damaging	1.00
IGL03141:Lrp2	APN	2	69477026	missense	probably damaging	0.99
IGL03154:Lrp2	APN	2	69549042	missense	probably damaging	1.00
IGL03155:Lrp2	APN	2	69455452	splice site	probably benign
IGL03163:Lrp2	APN	2	69501526	nonsense	probably null
IGL03164:Lrp2	APN	2	69464699	missense	probably damaging	1.00
IGL03169:Lrp2	APN	2	69523194	missense	probably damaging	1.00
IGL03174:Lrp2	APN	2	69466265	missense	probably damaging	1.00
IGL03189:Lrp2	APN	2	69438478	splice site	probably benign
IGL03288:Lrp2	APN	2	69426039	missense	probably benign	0.02
IGL03350:Lrp2	APN	2	69438453	missense	probably damaging	1.00
IGL03378:Lrp2	APN	2	69431152	missense	probably damaging	1.00
casual	UTSW	2	69499263	missense	probably benign
nonchalant	UTSW	2	69489329	missense	probably damaging	1.00
Presto	UTSW	2	69459531	nonsense	probably null
relaxed	UTSW	2	69535005	missense	probably damaging	1.00
unguarded	UTSW	2	69465758	missense	probably benign	0.00
Unintended	UTSW	2	69518443	missense	probably damaging	1.00
BB009:Lrp2	UTSW	2	69426027	missense	probably benign	0.00
BB019:Lrp2	UTSW	2	69426027	missense	probably benign	0.00
IGL02835:Lrp2	UTSW	2	69505304	missense	probably damaging	1.00
IGL03055:Lrp2	UTSW	2	69458448	missense	probably damaging	1.00
PIT4362001:Lrp2	UTSW	2	69537538	missense	probably damaging	1.00
PIT4504001:Lrp2	UTSW	2	69475403	missense	probably damaging	1.00
R0008:Lrp2	UTSW	2	69516551	missense	probably benign	0.42
R0008:Lrp2	UTSW	2	69516551	missense	probably benign	0.42
R0044:Lrp2	UTSW	2	69527555	missense	probably benign	0.01
R0044:Lrp2	UTSW	2	69527555	missense	probably damaging	0.96
R0048:Lrp2	UTSW	2	69465627	missense	probably damaging	1.00
R0098:Lrp2	UTSW	2	69475412	missense	probably damaging	1.00
R0098:Lrp2	UTSW	2	69475412	missense	probably damaging	1.00
R0103:Lrp2	UTSW	2	69477040	missense	probably benign
R0167:Lrp2	UTSW	2	69425658	missense	possibly damaging	0.95
R0226:Lrp2	UTSW	2	69537563	missense	probably null	1.00
R0243:Lrp2	UTSW	2	69428630	missense	probably benign	0.00
R0308:Lrp2	UTSW	2	69482982	splice site	probably benign
R0323:Lrp2	UTSW	2	69469639	missense	probably damaging	1.00
R0372:Lrp2	UTSW	2	69535043	missense	probably benign	0.10
R0374:Lrp2	UTSW	2	69430307	missense	probably damaging	1.00
R0391:Lrp2	UTSW	2	69456858	missense	probably damaging	0.99
R0391:Lrp2	UTSW	2	69460337	splice site	probably benign
R0395:Lrp2	UTSW	2	69433077	missense	possibly damaging	0.89
R0401:Lrp2	UTSW	2	69479148	missense	probably damaging	0.98
R0471:Lrp2	UTSW	2	69525234	missense	probably damaging	0.97
R0483:Lrp2	UTSW	2	69507801	missense	probably damaging	0.99
R0502:Lrp2	UTSW	2	69511017	missense	probably damaging	1.00
R0542:Lrp2	UTSW	2	69428654	missense	probably benign	0.00
R0544:Lrp2	UTSW	2	69491931	missense	probably benign	0.18
R0548:Lrp2	UTSW	2	69537638	splice site	probably benign
R0593:Lrp2	UTSW	2	69467006	missense	probably benign
R0608:Lrp2	UTSW	2	69486243	missense	probably benign	0.02
R0633:Lrp2	UTSW	2	69448120	missense	probably damaging	1.00
R0691:Lrp2	UTSW	2	69451380	missense	probably benign	0.19
R0718:Lrp2	UTSW	2	69510948	missense	probably damaging	1.00
R0737:Lrp2	UTSW	2	69448169	missense	probably damaging	0.96
R0771:Lrp2	UTSW	2	69507990	missense	probably damaging	1.00
R0784:Lrp2	UTSW	2	69518365	missense	probably benign	0.32
R0885:Lrp2	UTSW	2	69482353	missense	possibly damaging	0.75
R0947:Lrp2	UTSW	2	69487838	missense	probably damaging	1.00
R1235:Lrp2	UTSW	2	69524036	missense	probably damaging	1.00
R1293:Lrp2	UTSW	2	69523302	splice site	probably null
R1301:Lrp2	UTSW	2	69428604	missense	probably damaging	0.98
R1387:Lrp2	UTSW	2	69456918	missense	probably damaging	1.00
R1459:Lrp2	UTSW	2	69460477	missense	probably damaging	1.00
R1459:Lrp2	UTSW	2	69483394	missense	probably damaging	0.99
R1529:Lrp2	UTSW	2	69523182	missense	probably damaging	1.00
R1543:Lrp2	UTSW	2	69500730	missense	probably damaging	1.00
R1546:Lrp2	UTSW	2	69502610	missense	probably damaging	1.00
R1550:Lrp2	UTSW	2	69502661	missense	possibly damaging	0.74
R1590:Lrp2	UTSW	2	69466763	critical splice donor site	probably null
R1689:Lrp2	UTSW	2	69503529	missense	probably benign	0.09
R1693:Lrp2	UTSW	2	69510418	missense	probably damaging	1.00
R1753:Lrp2	UTSW	2	69496489	missense	possibly damaging	0.87
R1799:Lrp2	UTSW	2	69503530	missense	probably benign	0.04
R1834:Lrp2	UTSW	2	69466880	missense	probably benign	0.01
R1921:Lrp2	UTSW	2	69523287	missense	probably damaging	1.00
R2000:Lrp2	UTSW	2	69467090	missense	probably damaging	1.00
R2077:Lrp2	UTSW	2	69507843	missense	probably damaging	1.00
R2092:Lrp2	UTSW	2	69536021	missense	probably benign	0.25
R2093:Lrp2	UTSW	2	69536021	missense	probably benign	0.25
R2108:Lrp2	UTSW	2	69506624	missense	possibly damaging	0.75
R2117:Lrp2	UTSW	2	69483385	missense	probably benign	0.05
R2122:Lrp2	UTSW	2	69483707	missense	probably damaging	1.00
R2134:Lrp2	UTSW	2	69511067	missense	probably damaging	1.00
R2207:Lrp2	UTSW	2	69467028	missense	possibly damaging	0.94
R2248:Lrp2	UTSW	2	69511010	missense	probably damaging	1.00
R2264:Lrp2	UTSW	2	69482366	missense	possibly damaging	0.88
R2316:Lrp2	UTSW	2	69491847	missense	possibly damaging	0.75
R2513:Lrp2	UTSW	2	69506374	splice site	probably null
R2984:Lrp2	UTSW	2	69425814	splice site	probably null
R3085:Lrp2	UTSW	2	69467135	missense	probably benign	0.05
R3103:Lrp2	UTSW	2	69431984	missense	probably benign	0.00
R3727:Lrp2	UTSW	2	69510429	missense	probably damaging	1.00
R3730:Lrp2	UTSW	2	69464579	missense	probably damaging	0.99
R3730:Lrp2	UTSW	2	69534907	critical splice donor site	probably null
R3731:Lrp2	UTSW	2	69464579	missense	probably damaging	0.99
R3731:Lrp2	UTSW	2	69534907	critical splice donor site	probably null
R3764:Lrp2	UTSW	2	69496336	missense	probably damaging	1.00
R3768:Lrp2	UTSW	2	69505105	missense	probably benign	0.34
R3778:Lrp2	UTSW	2	69509204	missense	probably benign	0.00
R3808:Lrp2	UTSW	2	69501548	missense	probably damaging	1.00
R3809:Lrp2	UTSW	2	69501548	missense	probably damaging	1.00
R3813:Lrp2	UTSW	2	69464579	missense	probably damaging	0.99
R3828:Lrp2	UTSW	2	69426012	missense	probably benign	0.03
R3852:Lrp2	UTSW	2	69537565	missense	probably damaging	0.96
R3877:Lrp2	UTSW	2	69459472	critical splice donor site	probably null
R3877:Lrp2	UTSW	2	69549047	missense	probably damaging	1.00
R3922:Lrp2	UTSW	2	69506376	missense	probably benign
R4081:Lrp2	UTSW	2	69513273	missense	probably damaging	0.98
R4082:Lrp2	UTSW	2	69513273	missense	probably damaging	0.98
R4118:Lrp2	UTSW	2	69430262	critical splice donor site	probably null
R4193:Lrp2	UTSW	2	69467143	missense	probably damaging	1.00
R4284:Lrp2	UTSW	2	69480094	missense	possibly damaging	0.95
R4322:Lrp2	UTSW	2	69425991	nonsense	probably null
R4352:Lrp2	UTSW	2	69432182	critical splice donor site	probably null
R4407:Lrp2	UTSW	2	69502517	missense	probably damaging	1.00
R4408:Lrp2	UTSW	2	69467169	missense	probably benign	0.09
R4416:Lrp2	UTSW	2	69527231	missense	probably benign	0.18
R4426:Lrp2	UTSW	2	69506348	missense	probably benign	0.00
R4510:Lrp2	UTSW	2	69480062	missense	possibly damaging	0.58
R4511:Lrp2	UTSW	2	69480062	missense	possibly damaging	0.58
R4553:Lrp2	UTSW	2	69513285	missense	probably benign	0.13
R4591:Lrp2	UTSW	2	69536075	missense	probably damaging	1.00
R4612:Lrp2	UTSW	2	69458427	nonsense	probably null
R4622:Lrp2	UTSW	2	69460349	missense	possibly damaging	0.87
R4632:Lrp2	UTSW	2	69489129	splice site	probably null
R4633:Lrp2	UTSW	2	69461417	missense	probably benign	0.16
R4636:Lrp2	UTSW	2	69436639	missense	possibly damaging	0.93
R4657:Lrp2	UTSW	2	69466993	missense	probably damaging	1.00
R4667:Lrp2	UTSW	2	69489298	missense	probably benign	0.02
R4712:Lrp2	UTSW	2	69506551	missense	probably damaging	1.00
R4713:Lrp2	UTSW	2	69487966	missense	probably damaging	1.00
R4720:Lrp2	UTSW	2	69481173	missense	probably damaging	0.99
R4732:Lrp2	UTSW	2	69533555	missense	probably benign
R4733:Lrp2	UTSW	2	69533555	missense	probably benign
R4777:Lrp2	UTSW	2	69482264	missense	probably damaging	1.00
R4779:Lrp2	UTSW	2	69459715	missense	possibly damaging	0.75
R4786:Lrp2	UTSW	2	69537956	missense	probably damaging	1.00
R4842:Lrp2	UTSW	2	69469411	missense	probably benign	0.06
R4845:Lrp2	UTSW	2	69509241	missense	possibly damaging	0.71
R4846:Lrp2	UTSW	2	69479113	missense	probably damaging	1.00
R4938:Lrp2	UTSW	2	69472368	missense	probably damaging	0.98
R4951:Lrp2	UTSW	2	69535988	missense	probably damaging	1.00
R4990:Lrp2	UTSW	2	69481388	missense	probably benign	0.01
R5075:Lrp2	UTSW	2	69465758	missense	probably benign	0.00
R5078:Lrp2	UTSW	2	69501530	missense	possibly damaging	0.93
R5102:Lrp2	UTSW	2	69489158	missense	probably damaging	0.98
R5124:Lrp2	UTSW	2	69501490	missense	probably damaging	0.97
R5131:Lrp2	UTSW	2	69430342	missense	possibly damaging	0.74
R5141:Lrp2	UTSW	2	69552349	splice site	probably null
R5223:Lrp2	UTSW	2	69524053	missense	probably damaging	0.99
R5236:Lrp2	UTSW	2	69456819	splice site	probably null
R5267:Lrp2	UTSW	2	69548978	missense	possibly damaging	0.83
R5290:Lrp2	UTSW	2	69513354	missense	probably damaging	1.00
R5333:Lrp2	UTSW	2	69525228	missense	probably benign	0.01
R5355:Lrp2	UTSW	2	69454838	nonsense	probably null
R5356:Lrp2	UTSW	2	69464708	missense	possibly damaging	0.74
R5369:Lrp2	UTSW	2	69459560	missense	probably benign	0.04
R5486:Lrp2	UTSW	2	69437465	missense	probably benign	0.04
R5554:Lrp2	UTSW	2	69552424	missense	possibly damaging	0.92
R5584:Lrp2	UTSW	2	69451288	missense	probably damaging	1.00
R5585:Lrp2	UTSW	2	69464624	missense	possibly damaging	0.77
R5587:Lrp2	UTSW	2	69499263	missense	probably benign
R5605:Lrp2	UTSW	2	69523299	missense	probably damaging	1.00
R5637:Lrp2	UTSW	2	69472418	missense	probably damaging	1.00
R5647:Lrp2	UTSW	2	69519914	missense	probably null	0.80
R5686:Lrp2	UTSW	2	69511061	missense	possibly damaging	0.88
R5691:Lrp2	UTSW	2	69502553	missense	probably damaging	1.00
R5724:Lrp2	UTSW	2	69451382	missense	probably damaging	0.99
R5726:Lrp2	UTSW	2	69509147	missense	probably damaging	1.00
R5743:Lrp2	UTSW	2	69466877	missense	probably damaging	1.00
R5777:Lrp2	UTSW	2	69455525	missense	probably damaging	1.00
R5841:Lrp2	UTSW	2	69480153	missense	probably benign	0.00
R5892:Lrp2	UTSW	2	69442776	missense	probably benign
R5951:Lrp2	UTSW	2	69496323	splice site	probably null
R5974:Lrp2	UTSW	2	69459548	missense	probably damaging	1.00
R5980:Lrp2	UTSW	2	69535005	missense	probably damaging	1.00
R6046:Lrp2	UTSW	2	69506754	missense	probably damaging	1.00
R6113:Lrp2	UTSW	2	69483557	missense	possibly damaging	0.76
R6146:Lrp2	UTSW	2	69511001	missense	probably benign	0.00
R6177:Lrp2	UTSW	2	69510419	frame shift	probably null
R6180:Lrp2	UTSW	2	69503524	missense	possibly damaging	0.85
R6219:Lrp2	UTSW	2	69469478	missense	probably damaging	1.00
R6228:Lrp2	UTSW	2	69482366	missense	possibly damaging	0.88
R6265:Lrp2	UTSW	2	69466340	missense	probably damaging	1.00
R6312:Lrp2	UTSW	2	69436681	missense	probably damaging	1.00
R6337:Lrp2	UTSW	2	69438467	missense	probably damaging	1.00
R6376:Lrp2	UTSW	2	69483443	missense	probably benign	0.02
R6385:Lrp2	UTSW	2	69495784	missense	probably benign	0.22
R6429:Lrp2	UTSW	2	69461287	missense	probably damaging	1.00
R6458:Lrp2	UTSW	2	69505156	missense	probably benign	0.00
R6524:Lrp2	UTSW	2	69436639	missense	possibly damaging	0.93
R6555:Lrp2	UTSW	2	69509303	missense	probably benign	0.00
R6594:Lrp2	UTSW	2	69439923	missense	possibly damaging	0.58
R6599:Lrp2	UTSW	2	69469405	missense	probably damaging	1.00
R6655:Lrp2	UTSW	2	69453858	missense	probably benign	0.01
R6718:Lrp2	UTSW	2	69483780	missense	probably benign	0.09
R6736:Lrp2	UTSW	2	69448211	missense	probably benign	0.02
R6738:Lrp2	UTSW	2	69458488	missense	probably damaging	0.97
R6799:Lrp2	UTSW	2	69483904	missense	probably damaging	1.00
R6846:Lrp2	UTSW	2	69518443	missense	probably damaging	1.00
R6856:Lrp2	UTSW	2	69513268	missense	probably damaging	1.00
R6861:Lrp2	UTSW	2	69513377	missense	possibly damaging	0.77
R6888:Lrp2	UTSW	2	69524141	missense	probably damaging	0.98
R6897:Lrp2	UTSW	2	69510502	missense	probably benign
R6902:Lrp2	UTSW	2	69459503	missense	probably damaging	1.00
R6908:Lrp2	UTSW	2	69472365	missense	probably damaging	1.00
R6918:Lrp2	UTSW	2	69489305	missense	probably damaging	1.00
R6989:Lrp2	UTSW	2	69472455	missense	probably damaging	1.00
R7022:Lrp2	UTSW	2	69483208	missense	probably damaging	1.00
R7025:Lrp2	UTSW	2	69483028	missense	possibly damaging	0.90
R7026:Lrp2	UTSW	2	69521787	missense	probably damaging	0.97
R7138:Lrp2	UTSW	2	69465745	missense	possibly damaging	0.94
R7145:Lrp2	UTSW	2	69454808	critical splice donor site	probably null
R7150:Lrp2	UTSW	2	69488051	missense	probably damaging	0.99
R7165:Lrp2	UTSW	2	69506573	missense	probably damaging	0.99
R7174:Lrp2	UTSW	2	69433072	missense	probably benign	0.11
R7204:Lrp2	UTSW	2	69472533	missense	probably benign	0.25
R7275:Lrp2	UTSW	2	69459531	nonsense	probably null
R7278:Lrp2	UTSW	2	69486352	missense	probably damaging	1.00
R7296:Lrp2	UTSW	2	69482381	missense	probably benign	0.04
R7315:Lrp2	UTSW	2	69491822	missense	probably damaging	0.98
R7342:Lrp2	UTSW	2	69479290	missense	possibly damaging	0.95
R7351:Lrp2	UTSW	2	69448142	missense	probably damaging	1.00
R7352:Lrp2	UTSW	2	69472397	missense	probably benign	0.04
R7366:Lrp2	UTSW	2	69483806	missense	probably damaging	1.00
R7373:Lrp2	UTSW	2	69500692	missense	probably damaging	1.00
R7446:Lrp2	UTSW	2	69432213	missense	probably damaging	1.00
R7446:Lrp2	UTSW	2	69459674	missense	probably damaging	0.99
R7451:Lrp2	UTSW	2	69513333	missense	probably damaging	1.00
R7492:Lrp2	UTSW	2	69537581	missense	probably damaging	0.99
R7571:Lrp2	UTSW	2	69516403	missense	probably damaging	1.00
R7638:Lrp2	UTSW	2	69477008	critical splice donor site	probably null
R7664:Lrp2	UTSW	2	69506732	missense	probably damaging	1.00
R7686:Lrp2	UTSW	2	69489237	missense	probably damaging	1.00
R7711:Lrp2	UTSW	2	69479343	critical splice acceptor site	probably null
R7737:Lrp2	UTSW	2	69496438	missense	possibly damaging	0.77
R7763:Lrp2	UTSW	2	69503388	missense	probably damaging	0.99
R7775:Lrp2	UTSW	2	69501539	missense	possibly damaging	0.74
R7824:Lrp2	UTSW	2	69501539	missense	possibly damaging	0.74
R7840:Lrp2	UTSW	2	69464784	missense	probably damaging	0.98
R7878:Lrp2	UTSW	2	69507809	missense	probably damaging	1.00
R7878:Lrp2	UTSW	2	69507810	missense	probably damaging	1.00
R7895:Lrp2	UTSW	2	69458479	missense	probably damaging	0.97
R7898:Lrp2	UTSW	2	69441366	missense	probably benign	0.00
R7912:Lrp2	UTSW	2	69428672	missense	probably benign	0.03
R7923:Lrp2	UTSW	2	69438388	missense	possibly damaging	0.75
R7940:Lrp2	UTSW	2	69432197	missense	possibly damaging	0.91
R7954:Lrp2	UTSW	2	69503523	missense	possibly damaging	0.61
R8007:Lrp2	UTSW	2	69506505	missense	probably benign	0.02
R8084:Lrp2	UTSW	2	69509369	missense	probably damaging	0.97
R8087:Lrp2	UTSW	2	69448129	missense	probably damaging	1.00
R8090:Lrp2	UTSW	2	69464745	missense	possibly damaging	0.94
R8110:Lrp2	UTSW	2	69506453	missense	probably benign
R8129:Lrp2	UTSW	2	69430280	missense	possibly damaging	0.75
R8155:Lrp2	UTSW	2	69482998	missense	possibly damaging	0.74
R8182:Lrp2	UTSW	2	69489329	missense	probably damaging	1.00
R8239:Lrp2	UTSW	2	69481267	nonsense	probably null
R8247:Lrp2	UTSW	2	69431087	missense	possibly damaging	0.76
R8327:Lrp2	UTSW	2	69491924	missense	probably damaging	1.00
R8355:Lrp2	UTSW	2	69516484	missense	probably damaging	0.99
R8404:Lrp2	UTSW	2	69514241	nonsense	probably null
R8427:Lrp2	UTSW	2	69451297	missense	probably damaging	0.97
R8463:Lrp2	UTSW	2	69491906	missense	probably damaging	1.00
R8502:Lrp2	UTSW	2	69514241	nonsense	probably null
R8529:Lrp2	UTSW	2	69500642	missense	probably damaging	0.96
R8673:Lrp2	UTSW	2	69472460	missense	probably damaging	1.00
R8698:Lrp2	UTSW	2	69448239	missense	probably benign	0.39
R8698:Lrp2	UTSW	2	69458423	missense	probably benign	0.37
R8708:Lrp2	UTSW	2	69459613	missense	probably damaging	1.00
R8716:Lrp2	UTSW	2	69443794	missense	probably benign	0.04
R8723:Lrp2	UTSW	2	69486304	missense	probably damaging	1.00
R8787:Lrp2	UTSW	2	69552401	missense	probably damaging	1.00
R8903:Lrp2	UTSW	2	69549038	missense	possibly damaging	0.68
R8944:Lrp2	UTSW	2	69511004	missense	probably damaging	1.00
R9069:Lrp2	UTSW	2	69501652	missense	probably damaging	1.00
R9076:Lrp2	UTSW	2	69519916	missense	probably benign	0.01
R9155:Lrp2	UTSW	2	69461369	nonsense	probably null
R9173:Lrp2	UTSW	2	69469387	missense	probably damaging	1.00
R9254:Lrp2	UTSW	2	69503547	missense	probably benign	0.09
R9256:Lrp2	UTSW	2	69510959	missense	probably benign	0.03
R9291:Lrp2	UTSW	2	69480035	missense	probably damaging	1.00
R9335:Lrp2	UTSW	2	69428639	missense	probably benign	0.01
R9357:Lrp2	UTSW	2	69506573	missense	probably damaging	0.99
R9368:Lrp2	UTSW	2	69527635	missense	probably damaging	0.99
R9453:Lrp2	UTSW	2	69458488	missense	probably damaging	1.00
R9546:Lrp2	UTSW	2	69456821	critical splice donor site	probably null
R9554:Lrp2	UTSW	2	69431153	missense	probably damaging	1.00
R9597:Lrp2	UTSW	2	69430359	missense	probably benign	0.02
R9601:Lrp2	UTSW	2	69459584	missense	probably damaging	1.00
R9623:Lrp2	UTSW	2	69477079	missense	probably benign	0.09
RF016:Lrp2	UTSW	2	69509205	missense	probably benign
X0011:Lrp2	UTSW	2	69519998	missense	probably damaging	1.00
X0023:Lrp2	UTSW	2	69436600	missense	probably damaging	0.99
Z1176:Lrp2	UTSW	2	69480042	missense	possibly damaging	0.66
Z1176:Lrp2	UTSW	2	69507881	missense	possibly damaging	0.88
Z1177:Lrp2	UTSW	2	69451280	missense	probably damaging	1.00
Z1177:Lrp2	UTSW	2	69472453	missense	probably benign	0.03
Z1177:Lrp2	UTSW	2	69496468	missense	probably damaging	1.00
Z1177:Lrp2	UTSW	2	69501641	missense	probably damaging	1.00
Z1177:Lrp2	UTSW	2	69509289	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGTGTCCATCTGCAACC -3'
(R):5'- AGCTACTGTACAGGGACAGTTG -3'

Sequencing Primer
(F):5'- GTTCCCGGCATGATCATAAACAGTTC -3'
(R):5'- CCCACACCCTTAAGTTAATATG -3'

Posted On

2020-08-07