Incidental Mutation 'R0056:Satb1'
ID 64364
Institutional Source Beutler Lab
Gene Symbol Satb1
Ensembl Gene ENSMUSG00000023927
Gene Name special AT-rich sequence binding protein 1
Synonyms 2610306G12Rik
MMRRC Submission 038350-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0056 (G1)
Quality Score 91
Status Not validated
Chromosome 17
Chromosomal Location 52043215-52140318 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52047231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 695 (I695F)
Ref Sequence ENSEMBL: ENSMUSP00000118839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129667] [ENSMUST00000133574] [ENSMUST00000140979] [ENSMUST00000144331] [ENSMUST00000152830] [ENSMUST00000169480] [ENSMUST00000176669]
AlphaFold Q60611
Predicted Effect possibly damaging
Transcript: ENSMUST00000129667
AA Change: I664F

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116020
Gene: ENSMUSG00000023927
AA Change: I664F

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 619 N/A INTRINSIC
HOX 644 707 6.73e-10 SMART
low complexity region 720 730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133574
AA Change: I664F

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120536
Gene: ENSMUSG00000023927
AA Change: I664F

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137697
Predicted Effect probably damaging
Transcript: ENSMUST00000140979
AA Change: I695F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118839
Gene: ENSMUSG00000023927
AA Change: I695F

DomainStartEndE-ValueType
Pfam:ULD 72 170 3.2e-40 PFAM
Pfam:CUTL 176 247 1.6e-46 PFAM
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 616 661 N/A INTRINSIC
HOX 676 739 6.73e-10 SMART
low complexity region 752 762 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144331
AA Change: I664F

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116006
Gene: ENSMUSG00000023927
AA Change: I664F

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152830
AA Change: I664F

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119842
Gene: ENSMUSG00000023927
AA Change: I664F

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169480
AA Change: I664F

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128841
Gene: ENSMUSG00000023927
AA Change: I664F

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176669
AA Change: I664F

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134957
Gene: ENSMUSG00000023927
AA Change: I664F

DomainStartEndE-ValueType
PDB:3TUO|D 71 171 5e-66 PDB
PDB:3NZL|A 179 250 5e-45 PDB
Blast:CUT 245 327 9e-48 BLAST
CUT 362 448 1.08e-38 SMART
CUT 485 571 4.41e-39 SMART
low complexity region 593 620 N/A INTRINSIC
HOX 645 708 6.73e-10 SMART
low complexity region 721 731 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a matrix protein which binds nuclear matrix and scaffold-associating DNAs through a unique nuclear architecture. The protein recruits chromatin-remodeling factors in order to regulate chromatin structure and gene expression. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mice for a targeted null mutation exhibit reduced size of the lymphoid organs, abnormal T cell development, general growth retardation and die by 3-4 weeks of age. Mice homozegous for a different targeted allele exhibit postnatal growth retardation and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 A T 6: 118,382,190 (GRCm39) D449E probably benign Het
Etv3 T C 3: 87,443,135 (GRCm39) Y240H possibly damaging Het
Fscb T G 12: 64,521,021 (GRCm39) R148S possibly damaging Het
Mapk6 A G 9: 75,296,098 (GRCm39) Y467H possibly damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mogat1 T G 1: 78,500,407 (GRCm39) M157R probably damaging Het
Pold2 T A 11: 5,822,338 (GRCm39) S444C possibly damaging Het
Robo4 G A 9: 37,315,773 (GRCm39) R342Q probably benign Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Stk10 T A 11: 32,567,851 (GRCm39) N884K possibly damaging Het
Tex15 A G 8: 34,072,055 (GRCm39) H2534R probably benign Het
Ticam2 G T 18: 46,693,401 (GRCm39) Q229K possibly damaging Het
Other mutations in Satb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Satb1 APN 17 52,112,317 (GRCm39) missense probably damaging 1.00
IGL01658:Satb1 APN 17 52,082,279 (GRCm39) missense probably benign 0.33
IGL02070:Satb1 APN 17 52,047,095 (GRCm39) missense probably damaging 0.98
IGL02212:Satb1 APN 17 52,082,319 (GRCm39) missense possibly damaging 0.82
IGL02971:Satb1 APN 17 52,049,717 (GRCm39) missense possibly damaging 0.62
R0049:Satb1 UTSW 17 52,047,374 (GRCm39) missense probably benign 0.28
R0060:Satb1 UTSW 17 52,047,231 (GRCm39) missense probably damaging 1.00
R0067:Satb1 UTSW 17 52,111,364 (GRCm39) missense probably damaging 1.00
R0067:Satb1 UTSW 17 52,111,364 (GRCm39) missense probably damaging 1.00
R0113:Satb1 UTSW 17 52,089,726 (GRCm39) nonsense probably null
R0347:Satb1 UTSW 17 52,046,934 (GRCm39) nonsense probably null
R0667:Satb1 UTSW 17 52,089,889 (GRCm39) missense probably damaging 1.00
R1436:Satb1 UTSW 17 52,111,391 (GRCm39) splice site probably null
R1595:Satb1 UTSW 17 52,089,729 (GRCm39) missense possibly damaging 0.82
R1686:Satb1 UTSW 17 52,047,027 (GRCm39) missense probably benign 0.08
R1921:Satb1 UTSW 17 52,049,143 (GRCm39) nonsense probably null
R1952:Satb1 UTSW 17 52,047,173 (GRCm39) missense probably damaging 1.00
R2012:Satb1 UTSW 17 52,089,816 (GRCm39) nonsense probably null
R2156:Satb1 UTSW 17 52,047,438 (GRCm39) missense probably benign 0.02
R2180:Satb1 UTSW 17 52,110,524 (GRCm39) missense probably damaging 0.96
R2959:Satb1 UTSW 17 52,082,331 (GRCm39) missense possibly damaging 0.91
R3107:Satb1 UTSW 17 52,089,810 (GRCm39) missense possibly damaging 0.95
R3108:Satb1 UTSW 17 52,089,810 (GRCm39) missense possibly damaging 0.95
R3814:Satb1 UTSW 17 52,089,935 (GRCm39) missense probably damaging 0.98
R4109:Satb1 UTSW 17 52,111,378 (GRCm39) missense probably damaging 0.99
R4727:Satb1 UTSW 17 52,111,375 (GRCm39) missense probably damaging 1.00
R5209:Satb1 UTSW 17 52,116,235 (GRCm39) missense probably benign 0.26
R5652:Satb1 UTSW 17 52,049,823 (GRCm39) missense probably damaging 1.00
R5815:Satb1 UTSW 17 52,089,981 (GRCm39) missense possibly damaging 0.92
R6141:Satb1 UTSW 17 52,082,404 (GRCm39) missense possibly damaging 0.93
R6370:Satb1 UTSW 17 52,089,825 (GRCm39) missense possibly damaging 0.94
R7371:Satb1 UTSW 17 52,090,008 (GRCm39) nonsense probably null
R7409:Satb1 UTSW 17 52,116,217 (GRCm39) missense possibly damaging 0.90
R7471:Satb1 UTSW 17 52,090,029 (GRCm39) missense probably damaging 0.96
R7568:Satb1 UTSW 17 52,089,752 (GRCm39) missense possibly damaging 0.88
R7626:Satb1 UTSW 17 52,074,995 (GRCm39) missense probably benign 0.25
R7749:Satb1 UTSW 17 52,074,961 (GRCm39) missense possibly damaging 0.70
R7863:Satb1 UTSW 17 52,112,350 (GRCm39) missense possibly damaging 0.91
R8339:Satb1 UTSW 17 52,089,977 (GRCm39) missense probably damaging 0.97
R8429:Satb1 UTSW 17 52,074,978 (GRCm39) missense probably damaging 1.00
R8987:Satb1 UTSW 17 52,112,381 (GRCm39) missense probably damaging 1.00
R9160:Satb1 UTSW 17 52,047,053 (GRCm39) missense probably benign
R9251:Satb1 UTSW 17 52,112,293 (GRCm39) missense probably damaging 1.00
R9656:Satb1 UTSW 17 52,112,264 (GRCm39) missense possibly damaging 0.95
Z1088:Satb1 UTSW 17 52,089,980 (GRCm39) missense probably damaging 0.98
Z1088:Satb1 UTSW 17 52,089,967 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCGGCATTAACGTCTGTGCTC -3'
(R):5'- CTTGTCTCTTTGCAGCAGCAGC -3'

Sequencing Primer
(F):5'- CTTCCTCTAGTTTCACTGAGAAAAGG -3'
(R):5'- agcagcagcaacagcag -3'
Posted On 2013-08-06