Incidental Mutation 'R7932:Igkv16-104'
ID 643643
Institutional Source Beutler Lab
Gene Symbol Igkv16-104
Ensembl Gene ENSMUSG00000076522
Gene Name immunoglobulin kappa variable 16-104
Synonyms LOC381778
MMRRC Submission 045649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R7932 (G1)
Quality Score 999
Status Not validated
Chromosome 6
Chromosomal Location 68402589-68403056 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68402778 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 24 (I24L)
Ref Sequence ENSEMBL: ENSMUSP00000100124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103323]
AlphaFold A0A0B4J1I1
Predicted Effect probably benign
Transcript: ENSMUST00000103323
AA Change: I24L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100124
Gene: ENSMUSG00000076522
AA Change: I24L

DomainStartEndE-ValueType
IGv 38 110 7.33e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,415,100 (GRCm39) R666G unknown Het
Adam21 T A 12: 81,606,938 (GRCm39) N275Y probably damaging Het
Adam33 G A 2: 130,905,617 (GRCm39) probably benign Het
Arhgap24 A T 5: 102,993,835 (GRCm39) probably benign Het
Arhgef1 C T 7: 24,619,135 (GRCm39) L459F probably damaging Het
Bbx A T 16: 50,030,806 (GRCm39) probably null Het
Blk C T 14: 63,611,008 (GRCm39) G445S possibly damaging Het
Brca1 T C 11: 101,430,843 (GRCm39) E33G possibly damaging Het
Cacna1s T G 1: 136,012,097 (GRCm39) L513R probably damaging Het
Cnn3 T A 3: 121,245,078 (GRCm39) M98K probably benign Het
Cttnbp2 T A 6: 18,427,532 (GRCm39) L716F probably damaging Het
Dlgap1 A T 17: 70,823,233 (GRCm39) R73W probably damaging Het
Dnajc4 A G 19: 6,965,638 (GRCm39) L182P probably damaging Het
Dock2 T C 11: 34,217,998 (GRCm39) M1191V probably benign Het
Fam13a C T 6: 58,960,873 (GRCm39) probably null Het
Fbn2 C T 18: 58,153,555 (GRCm39) G2569E possibly damaging Het
Fes T C 7: 80,029,620 (GRCm39) I623V probably damaging Het
Fyco1 A C 9: 123,658,055 (GRCm39) L707R possibly damaging Het
Gadd45b T A 10: 80,766,169 (GRCm39) V7E possibly damaging Het
Gm19410 T A 8: 36,262,753 (GRCm39) C897S probably damaging Het
Hk1 A G 10: 62,151,299 (GRCm39) L31P probably damaging Het
Hoxa4 T G 6: 52,167,397 (GRCm39) K261N probably damaging Het
Hrh4 T A 18: 13,148,869 (GRCm39) L77* probably null Het
Igf1r A T 7: 67,861,802 (GRCm39) I1121F possibly damaging Het
Itk A T 11: 46,231,519 (GRCm39) W346R probably benign Het
Kdm2a A G 19: 4,369,184 (GRCm39) S1144P probably damaging Het
Krt86 A T 15: 101,374,473 (GRCm39) S289C probably damaging Het
Lonrf1 T C 8: 36,690,070 (GRCm39) I663V probably benign Het
Lrp2 T G 2: 69,256,371 (GRCm39) I4590L probably benign Het
Lrrc8d C T 5: 105,960,891 (GRCm39) R434C probably damaging Het
Maneal T C 4: 124,755,638 (GRCm39) Y108C probably damaging Het
Muc21 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,933,525 (GRCm39) probably benign Het
Myh8 G A 11: 67,185,430 (GRCm39) V894I probably benign Het
Ncam2 T G 16: 81,412,708 (GRCm39) L732R probably damaging Het
Nsun4 A T 4: 115,901,997 (GRCm39) D156E probably damaging Het
Or10z1 T C 1: 174,078,260 (GRCm39) I78V probably benign Het
Or1e23 A C 11: 73,407,983 (GRCm39) L14R probably damaging Het
Or2n1d A T 17: 38,646,146 (GRCm39) I33L probably benign Het
Or5b106 A T 19: 13,123,345 (GRCm39) M226K probably benign Het
Or5v1b T C 17: 37,841,075 (GRCm39) I69T probably benign Het
Or6c66 C A 10: 129,461,094 (GRCm39) V279F probably damaging Het
P2rx7 G A 5: 122,782,245 (GRCm39) V37I probably benign Het
Pcdh15 A G 10: 74,481,359 (GRCm39) R235G probably benign Het
Pcdhga1 T C 18: 37,796,513 (GRCm39) S506P probably damaging Het
Pira2 A T 7: 3,845,435 (GRCm39) probably null Het
Plch1 A G 3: 63,609,402 (GRCm39) V935A probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Prpf8 A G 11: 75,383,423 (GRCm39) D607G possibly damaging Het
Ptdss1 T C 13: 67,114,496 (GRCm39) W215R probably damaging Het
Ptpn9 C A 9: 56,943,900 (GRCm39) P258Q possibly damaging Het
Rfpl4b A G 10: 38,697,346 (GRCm39) V85A possibly damaging Het
Sacs C A 14: 61,442,327 (GRCm39) Q1458K probably damaging Het
Scfd2 A T 5: 74,692,211 (GRCm39) S24T probably benign Het
Siae A G 9: 37,544,980 (GRCm39) D325G probably benign Het
Slc22a23 C A 13: 34,366,960 (GRCm39) A683S probably damaging Het
Slc44a3 A T 3: 121,306,009 (GRCm39) I244N possibly damaging Het
Srrm2 T A 17: 24,037,501 (GRCm39) S1382T probably benign Het
Tfap2c A G 2: 172,393,706 (GRCm39) Y207C probably damaging Het
Timd5 C A 11: 46,426,366 (GRCm39) P158T probably benign Het
Tnc T C 4: 63,926,857 (GRCm39) I890V probably benign Het
Trim30a A T 7: 104,078,545 (GRCm39) I177N probably benign Het
Tshz2 T A 2: 169,728,251 (GRCm39) M949K possibly damaging Het
Ttn T G 2: 76,555,530 (GRCm39) T30492P probably damaging Het
Ubb C T 11: 62,443,611 (GRCm39) Q214* probably null Het
Ulk2 A G 11: 61,698,916 (GRCm39) S423P probably benign Het
Vmn1r237 C A 17: 21,534,725 (GRCm39) D149E probably benign Het
Zbtb24 A G 10: 41,327,504 (GRCm39) D130G probably benign Het
Zfp689 C A 7: 127,043,523 (GRCm39) G369V probably damaging Het
Zg16 A G 7: 126,649,577 (GRCm39) F128S probably damaging Het
Zmym1 T G 4: 126,944,578 (GRCm39) N203T possibly damaging Het
Other mutations in Igkv16-104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Igkv16-104 APN 6 68,402,594 (GRCm39) missense possibly damaging 0.60
IGL02214:Igkv16-104 APN 6 68,402,778 (GRCm39) missense probably benign 0.00
BB009:Igkv16-104 UTSW 6 68,402,778 (GRCm39) missense probably benign 0.00
BB019:Igkv16-104 UTSW 6 68,402,778 (GRCm39) missense probably benign 0.00
R2907:Igkv16-104 UTSW 6 68,402,911 (GRCm39) missense probably damaging 0.98
R4688:Igkv16-104 UTSW 6 68,402,878 (GRCm39) missense possibly damaging 0.91
R4812:Igkv16-104 UTSW 6 68,402,829 (GRCm39) missense possibly damaging 0.91
R8064:Igkv16-104 UTSW 6 68,402,875 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTGCCAGGACACAGTTTAG -3'
(R):5'- TCCACTGCCACTGAACCTTG -3'

Sequencing Primer
(F):5'- CCTGCCAGGACACAGTTTAGATATG -3'
(R):5'- GCCACTGAACCTTGATGGAATTC -3'
Posted On 2020-08-07