Mutagenetix > Incidental Mutation

Incidental Mutation 'R7932:Prpf8'

643670

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R7932 (G1)

Quality Score

999

Status

Not validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75492597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 607 (D607G)

Ref Sequence

ENSEMBL: ENSMUSP00000018449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: D607G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: D607G

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: D607G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: D607G

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131283
AA Change: D552G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850
AA Change: D552G

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,573,180	R666G	unknown	Het
Adam21	T	A	12: 81,560,164	N275Y	probably damaging	Het
Adam33	G	A	2: 131,063,697		probably benign	Het
Arhgap24	A	T	5: 102,845,969		probably benign	Het
Arhgef1	C	T	7: 24,919,710	L459F	probably damaging	Het
Bbx	A	T	16: 50,210,443		probably null	Het
Blk	C	T	14: 63,373,559	G445S	possibly damaging	Het
Brca1	T	C	11: 101,540,017	E33G	possibly damaging	Het
Cacna1s	T	G	1: 136,084,359	L513R	probably damaging	Het
Cnn3	T	A	3: 121,451,429	M98K	probably benign	Het
Cttnbp2	T	A	6: 18,427,533	L716F	probably damaging	Het
Dlgap1	A	T	17: 70,516,238	R73W	probably damaging	Het
Dnajc4	A	G	19: 6,988,270	L182P	probably damaging	Het
Dock2	T	C	11: 34,267,998	M1191V	probably benign	Het
Fam13a	C	T	6: 58,983,888		probably null	Het
Fbn2	C	T	18: 58,020,483	G2569E	possibly damaging	Het
Fes	T	C	7: 80,379,872	I623V	probably damaging	Het
Fyco1	A	C	9: 123,828,990	L707R	possibly damaging	Het
Gadd45b	T	A	10: 80,930,335	V7E	possibly damaging	Het
Gm12169	C	A	11: 46,535,539	P158T	probably benign	Het
Gm19410	T	A	8: 35,795,599	C897S	probably damaging	Het
Gm9573	TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT	TCCTGAGGCAGTGCTGGAT	17: 35,622,633		probably benign	Het
Hk1	A	G	10: 62,315,520	L31P	probably damaging	Het
Hoxa4	T	G	6: 52,190,417	K261N	probably damaging	Het
Hrh4	T	A	18: 13,015,812	L77*	probably null	Het
Igf1r	A	T	7: 68,212,054	I1121F	possibly damaging	Het
Igkv16-104	A	T	6: 68,425,794	I24L	probably benign	Het
Itk	A	T	11: 46,340,692	W346R	probably benign	Het
Kdm2a	A	G	19: 4,319,156	S1144P	probably damaging	Het
Krt86	A	T	15: 101,476,592	S289C	probably damaging	Het
Lonrf1	T	C	8: 36,222,916	I663V	probably benign	Het
Lrp2	T	G	2: 69,426,027	I4590L	probably benign	Het
Lrrc8d	C	T	5: 105,813,025	R434C	probably damaging	Het
Maneal	T	C	4: 124,861,845	Y108C	probably damaging	Het
Myh8	G	A	11: 67,294,604	V894I	probably benign	Het
Ncam2	T	G	16: 81,615,820	L732R	probably damaging	Het
Nsun4	A	T	4: 116,044,800	D156E	probably damaging	Het
Olfr111	T	C	17: 37,530,184	I69T	probably benign	Het
Olfr136	A	T	17: 38,335,255	I33L	probably benign	Het
Olfr1459	A	T	19: 13,145,981	M226K	probably benign	Het
Olfr382	A	C	11: 73,517,157	L14R	probably damaging	Het
Olfr419	T	C	1: 174,250,694	I78V	probably benign	Het
Olfr798	C	A	10: 129,625,225	V279F	probably damaging	Het
P2rx7	G	A	5: 122,644,182	V37I	probably benign	Het
Pcdh15	A	G	10: 74,645,527	R235G	probably benign	Het
Pcdhga1	T	C	18: 37,663,460	S506P	probably damaging	Het
Pira2	A	T	7: 3,842,436		probably null	Het
Plch1	A	G	3: 63,701,981	V935A	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ptdss1	T	C	13: 66,966,432	W215R	probably damaging	Het
Ptpn9	C	A	9: 57,036,616	P258Q	possibly damaging	Het
Rfpl4b	A	G	10: 38,821,350	V85A	possibly damaging	Het
Sacs	C	A	14: 61,204,878	Q1458K	probably damaging	Het
Scfd2	A	T	5: 74,531,550	S24T	probably benign	Het
Siae	A	G	9: 37,633,684	D325G	probably benign	Het
Slc22a23	C	A	13: 34,182,977	A683S	probably damaging	Het
Slc44a3	A	T	3: 121,512,360	I244N	possibly damaging	Het
Srrm2	T	A	17: 23,818,527	S1382T	probably benign	Het
Tfap2c	A	G	2: 172,551,786	Y207C	probably damaging	Het
Tnc	T	C	4: 64,008,620	I890V	probably benign	Het
Trim30a	A	T	7: 104,429,338	I177N	probably benign	Het
Tshz2	T	A	2: 169,886,331	M949K	possibly damaging	Het
Ttn	T	G	2: 76,725,186	T30492P	probably damaging	Het
Ubb	C	T	11: 62,552,785	Q214*	probably null	Het
Ulk2	A	G	11: 61,808,090	S423P	probably benign	Het
Vmn1r237	C	A	17: 21,314,463	D149E	probably benign	Het
Zbtb24	A	G	10: 41,451,508	D130G	probably benign	Het
Zfp689	C	A	7: 127,444,351	G369V	probably damaging	Het
Zg16	A	G	7: 127,050,405	F128S	probably damaging	Het
Zmym1	T	G	4: 127,050,785	N203T	possibly damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75496158	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75508548	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75493957	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75496044	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75503660	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75494782	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75494855	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75503431	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GCAATGTAGATGCCTTCCAGG -3'
(R):5'- GGAAGTGCTGTGATTCACTGAG -3'

Sequencing Primer
(F):5'- TAGATGCCTTCCAGGTGAGGC -3'
(R):5'- AAGTGCTGTGATTCACTGAGTATAG -3'

Posted On

2020-08-07