Incidental Mutation 'R7932:Sacs'
ID643675
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7932 (G1)
Quality Score999
Status Not validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61204878 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1458 (Q1458K)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943] [ENSMUST00000229692]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119943
AA Change: Q1458K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: Q1458K

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,573,180 R666G unknown Het
Adam21 T A 12: 81,560,164 N275Y probably damaging Het
Adam33 G A 2: 131,063,697 probably benign Het
Arhgap24 A T 5: 102,845,969 probably benign Het
Arhgef1 C T 7: 24,919,710 L459F probably damaging Het
Bbx A T 16: 50,210,443 probably null Het
Blk C T 14: 63,373,559 G445S possibly damaging Het
Brca1 T C 11: 101,540,017 E33G possibly damaging Het
Cacna1s T G 1: 136,084,359 L513R probably damaging Het
Cnn3 T A 3: 121,451,429 M98K probably benign Het
Cttnbp2 T A 6: 18,427,533 L716F probably damaging Het
Dlgap1 A T 17: 70,516,238 R73W probably damaging Het
Dnajc4 A G 19: 6,988,270 L182P probably damaging Het
Dock2 T C 11: 34,267,998 M1191V probably benign Het
Fam13a C T 6: 58,983,888 probably null Het
Fbn2 C T 18: 58,020,483 G2569E possibly damaging Het
Fes T C 7: 80,379,872 I623V probably damaging Het
Fyco1 A C 9: 123,828,990 L707R possibly damaging Het
Gadd45b T A 10: 80,930,335 V7E possibly damaging Het
Gm12169 C A 11: 46,535,539 P158T probably benign Het
Gm19410 T A 8: 35,795,599 C897S probably damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Hk1 A G 10: 62,315,520 L31P probably damaging Het
Hoxa4 T G 6: 52,190,417 K261N probably damaging Het
Hrh4 T A 18: 13,015,812 L77* probably null Het
Igf1r A T 7: 68,212,054 I1121F possibly damaging Het
Igkv16-104 A T 6: 68,425,794 I24L probably benign Het
Itk A T 11: 46,340,692 W346R probably benign Het
Kdm2a A G 19: 4,319,156 S1144P probably damaging Het
Krt86 A T 15: 101,476,592 S289C probably damaging Het
Lonrf1 T C 8: 36,222,916 I663V probably benign Het
Lrp2 T G 2: 69,426,027 I4590L probably benign Het
Lrrc8d C T 5: 105,813,025 R434C probably damaging Het
Maneal T C 4: 124,861,845 Y108C probably damaging Het
Myh8 G A 11: 67,294,604 V894I probably benign Het
Ncam2 T G 16: 81,615,820 L732R probably damaging Het
Nsun4 A T 4: 116,044,800 D156E probably damaging Het
Olfr111 T C 17: 37,530,184 I69T probably benign Het
Olfr136 A T 17: 38,335,255 I33L probably benign Het
Olfr1459 A T 19: 13,145,981 M226K probably benign Het
Olfr382 A C 11: 73,517,157 L14R probably damaging Het
Olfr419 T C 1: 174,250,694 I78V probably benign Het
Olfr798 C A 10: 129,625,225 V279F probably damaging Het
P2rx7 G A 5: 122,644,182 V37I probably benign Het
Pcdh15 A G 10: 74,645,527 R235G probably benign Het
Pcdhga1 T C 18: 37,663,460 S506P probably damaging Het
Pira2 A T 7: 3,842,436 probably null Het
Plch1 A G 3: 63,701,981 V935A probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prpf8 A G 11: 75,492,597 D607G possibly damaging Het
Ptdss1 T C 13: 66,966,432 W215R probably damaging Het
Ptpn9 C A 9: 57,036,616 P258Q possibly damaging Het
Rfpl4b A G 10: 38,821,350 V85A possibly damaging Het
Scfd2 A T 5: 74,531,550 S24T probably benign Het
Siae A G 9: 37,633,684 D325G probably benign Het
Slc22a23 C A 13: 34,182,977 A683S probably damaging Het
Slc44a3 A T 3: 121,512,360 I244N possibly damaging Het
Srrm2 T A 17: 23,818,527 S1382T probably benign Het
Tfap2c A G 2: 172,551,786 Y207C probably damaging Het
Tnc T C 4: 64,008,620 I890V probably benign Het
Trim30a A T 7: 104,429,338 I177N probably benign Het
Tshz2 T A 2: 169,886,331 M949K possibly damaging Het
Ttn T G 2: 76,725,186 T30492P probably damaging Het
Ubb C T 11: 62,552,785 Q214* probably null Het
Ulk2 A G 11: 61,808,090 S423P probably benign Het
Vmn1r237 C A 17: 21,314,463 D149E probably benign Het
Zbtb24 A G 10: 41,451,508 D130G probably benign Het
Zfp689 C A 7: 127,444,351 G369V probably damaging Het
Zg16 A G 7: 127,050,405 F128S probably damaging Het
Zmym1 T G 4: 127,050,785 N203T possibly damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
BB009:Sacs UTSW 14 61204878 missense probably damaging 0.99
BB019:Sacs UTSW 14 61204878 missense probably damaging 0.99
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 splice site probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 splice site probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 splice site probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
R7023:Sacs UTSW 14 61208815 missense probably benign 0.04
R7047:Sacs UTSW 14 61213002 missense probably damaging 1.00
R7051:Sacs UTSW 14 61208928 missense probably benign 0.25
R7069:Sacs UTSW 14 61212496 missense probably damaging 1.00
R7082:Sacs UTSW 14 61210517 missense possibly damaging 0.94
R7108:Sacs UTSW 14 61211009 nonsense probably null
R7122:Sacs UTSW 14 61210396 missense probably damaging 1.00
R7194:Sacs UTSW 14 61210089 missense possibly damaging 0.95
R7214:Sacs UTSW 14 61191792 missense probably benign
R7221:Sacs UTSW 14 61208806 missense probably damaging 0.99
R7274:Sacs UTSW 14 61214081 missense possibly damaging 0.88
R7344:Sacs UTSW 14 61207444 missense possibly damaging 0.81
R7440:Sacs UTSW 14 61191605 missense probably benign 0.10
R7474:Sacs UTSW 14 61211178 missense probably benign 0.04
R7512:Sacs UTSW 14 61204430 missense probably benign 0.04
R7641:Sacs UTSW 14 61202871 missense probably damaging 0.97
R7649:Sacs UTSW 14 61203228 missense possibly damaging 0.53
R7703:Sacs UTSW 14 61206090 missense possibly damaging 0.81
R7792:Sacs UTSW 14 61209773 missense probably benign 0.00
R7805:Sacs UTSW 14 61203591 missense not run
R7822:Sacs UTSW 14 61192203 missense probably benign 0.03
R7882:Sacs UTSW 14 61207071 missense probably benign 0.02
R8031:Sacs UTSW 14 61204191 missense probably damaging 0.96
R8064:Sacs UTSW 14 61192175 missense possibly damaging 0.92
R8083:Sacs UTSW 14 61210717 missense possibly damaging 0.77
R8204:Sacs UTSW 14 61212948 missense probably damaging 0.96
R8293:Sacs UTSW 14 61191099 missense probably damaging 0.99
R8316:Sacs UTSW 14 61189619 missense possibly damaging 0.84
R8393:Sacs UTSW 14 61173206 start codon destroyed probably null 0.06
R8434:Sacs UTSW 14 61213187 nonsense probably null
R8482:Sacs UTSW 14 61202955 missense probably benign
R8497:Sacs UTSW 14 61192253 missense probably benign 0.00
R8557:Sacs UTSW 14 61207276 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Z1176:Sacs UTSW 14 61210830 nonsense probably null
Z1176:Sacs UTSW 14 61213200 missense probably damaging 1.00
Z1177:Sacs UTSW 14 61191551 missense possibly damaging 0.48
Z1177:Sacs UTSW 14 61207981 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCTTCCAAACTTGTCATGAAGC -3'
(R):5'- TCCATGACAAGCTGCCATCC -3'

Sequencing Primer
(F):5'- TGAAGCCAATTCATGAATGCTG -3'
(R):5'- AAGCTGCCATCCCTGGGTC -3'
Posted On2020-08-07