Mutagenetix > Incidental Mutations

Incidental Mutation 'R7932:Ncam2'

643679

Institutional Source

Beutler Lab

Gene Symbol

Ncam2

Ensembl Gene

ENSMUSG00000022762

Gene Name

neural cell adhesion molecule 2

Synonyms

Ocam, RNCAM, Ncam-2, R4B12 antigen

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7932 (G1)

Quality Score

999

Status

Not validated

Chromosome

Chromosomal Location

81200697-81626828 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 81615820 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 732 (L732R)

Ref Sequence

ENSEMBL: ENSMUSP00000063468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067602]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067602
AA Change: L732R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: L732R

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,573,180	R666G	unknown	Het
Adam21	T	A	12: 81,560,164	N275Y	probably damaging	Het
Adam33	G	A	2: 131,063,697		probably benign	Het
Arhgap24	A	T	5: 102,845,969		probably benign	Het
Arhgef1	C	T	7: 24,919,710	L459F	probably damaging	Het
Bbx	A	T	16: 50,210,443		probably null	Het
Blk	C	T	14: 63,373,559	G445S	possibly damaging	Het
Brca1	T	C	11: 101,540,017	E33G	possibly damaging	Het
Cacna1s	T	G	1: 136,084,359	L513R	probably damaging	Het
Cnn3	T	A	3: 121,451,429	M98K	probably benign	Het
Cttnbp2	T	A	6: 18,427,533	L716F	probably damaging	Het
Dlgap1	A	T	17: 70,516,238	R73W	probably damaging	Het
Dnajc4	A	G	19: 6,988,270	L182P	probably damaging	Het
Dock2	T	C	11: 34,267,998	M1191V	probably benign	Het
Fam13a	C	T	6: 58,983,888		probably null	Het
Fbn2	C	T	18: 58,020,483	G2569E	possibly damaging	Het
Fes	T	C	7: 80,379,872	I623V	probably damaging	Het
Fyco1	A	C	9: 123,828,990	L707R	possibly damaging	Het
Gadd45b	T	A	10: 80,930,335	V7E	possibly damaging	Het
Gm12169	C	A	11: 46,535,539	P158T	probably benign	Het
Gm19410	T	A	8: 35,795,599	C897S	probably damaging	Het
Gm9573	TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT	TCCTGAGGCAGTGCTGGAT	17: 35,622,633		probably benign	Het
Hk1	A	G	10: 62,315,520	L31P	probably damaging	Het
Hoxa4	T	G	6: 52,190,417	K261N	probably damaging	Het
Hrh4	T	A	18: 13,015,812	L77*	probably null	Het
Igf1r	A	T	7: 68,212,054	I1121F	possibly damaging	Het
Igkv16-104	A	T	6: 68,425,794	I24L	probably benign	Het
Itk	A	T	11: 46,340,692	W346R	probably benign	Het
Kdm2a	A	G	19: 4,319,156	S1144P	probably damaging	Het
Krt86	A	T	15: 101,476,592	S289C	probably damaging	Het
Lonrf1	T	C	8: 36,222,916	I663V	probably benign	Het
Lrp2	T	G	2: 69,426,027	I4590L	probably benign	Het
Lrrc8d	C	T	5: 105,813,025	R434C	probably damaging	Het
Maneal	T	C	4: 124,861,845	Y108C	probably damaging	Het
Myh8	G	A	11: 67,294,604	V894I	probably benign	Het
Nsun4	A	T	4: 116,044,800	D156E	probably damaging	Het
Olfr111	T	C	17: 37,530,184	I69T	probably benign	Het
Olfr136	A	T	17: 38,335,255	I33L	probably benign	Het
Olfr1459	A	T	19: 13,145,981	M226K	probably benign	Het
Olfr382	A	C	11: 73,517,157	L14R	probably damaging	Het
Olfr419	T	C	1: 174,250,694	I78V	probably benign	Het
Olfr798	C	A	10: 129,625,225	V279F	probably damaging	Het
P2rx7	G	A	5: 122,644,182	V37I	probably benign	Het
Pcdh15	A	G	10: 74,645,527	R235G	probably benign	Het
Pcdhga1	T	C	18: 37,663,460	S506P	probably damaging	Het
Pira2	A	T	7: 3,842,436		probably null	Het
Plch1	A	G	3: 63,701,981	V935A	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Prpf8	A	G	11: 75,492,597	D607G	possibly damaging	Het
Ptdss1	T	C	13: 66,966,432	W215R	probably damaging	Het
Ptpn9	C	A	9: 57,036,616	P258Q	possibly damaging	Het
Rfpl4b	A	G	10: 38,821,350	V85A	possibly damaging	Het
Sacs	C	A	14: 61,204,878	Q1458K	probably damaging	Het
Scfd2	A	T	5: 74,531,550	S24T	probably benign	Het
Siae	A	G	9: 37,633,684	D325G	probably benign	Het
Slc22a23	C	A	13: 34,182,977	A683S	probably damaging	Het
Slc44a3	A	T	3: 121,512,360	I244N	possibly damaging	Het
Srrm2	T	A	17: 23,818,527	S1382T	probably benign	Het
Tfap2c	A	G	2: 172,551,786	Y207C	probably damaging	Het
Tnc	T	C	4: 64,008,620	I890V	probably benign	Het
Trim30a	A	T	7: 104,429,338	I177N	probably benign	Het
Tshz2	T	A	2: 169,886,331	M949K	possibly damaging	Het
Ttn	T	G	2: 76,725,186	T30492P	probably damaging	Het
Ubb	C	T	11: 62,552,785	Q214*	probably null	Het
Ulk2	A	G	11: 61,808,090	S423P	probably benign	Het
Vmn1r237	C	A	17: 21,314,463	D149E	probably benign	Het
Zbtb24	A	G	10: 41,451,508	D130G	probably benign	Het
Zfp689	C	A	7: 127,444,351	G369V	probably damaging	Het
Zg16	A	G	7: 127,050,405	F128S	probably damaging	Het
Zmym1	T	G	4: 127,050,785	N203T	possibly damaging	Het

Other mutations in Ncam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Ncam2	APN	16	81517579	missense	probably damaging	1.00
IGL01369:Ncam2	APN	16	81461571	missense	probably benign	0.09
IGL01554:Ncam2	APN	16	81512935	missense	possibly damaging	0.88
IGL01892:Ncam2	APN	16	81589699	missense	possibly damaging	0.71
IGL02320:Ncam2	APN	16	81434837	missense	probably damaging	0.99
IGL02669:Ncam2	APN	16	81517541	missense	probably benign	0.18
IGL03073:Ncam2	APN	16	81621347	missense	possibly damaging	0.70
IGL03353:Ncam2	APN	16	81434900	missense	probably benign	0.04
BB009:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
BB019:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R0087:Ncam2	UTSW	16	81434901	missense	probably benign	0.11
R0097:Ncam2	UTSW	16	81517537	missense	probably damaging	1.00
R0276:Ncam2	UTSW	16	81517629	splice site	probably benign
R0279:Ncam2	UTSW	16	81623337	splice site	probably benign
R0471:Ncam2	UTSW	16	81200884	start gained	probably benign
R0523:Ncam2	UTSW	16	81461643	missense	probably damaging	0.99
R1353:Ncam2	UTSW	16	81200915	start codon destroyed	probably null
R1646:Ncam2	UTSW	16	81465706	critical splice donor site	probably benign
R1884:Ncam2	UTSW	16	81437683	missense	probably damaging	1.00
R2002:Ncam2	UTSW	16	81589698	missense	possibly damaging	0.70
R2157:Ncam2	UTSW	16	81490389	missense	probably damaging	1.00
R2330:Ncam2	UTSW	16	81512921	missense	probably benign	0.17
R2404:Ncam2	UTSW	16	81490240	splice site	probably benign
R2434:Ncam2	UTSW	16	81595225	missense	probably benign	0.01
R3104:Ncam2	UTSW	16	81465710	splice site	probably benign
R3842:Ncam2	UTSW	16	81434810	missense	probably damaging	1.00
R3954:Ncam2	UTSW	16	81589724	missense	probably damaging	1.00
R4039:Ncam2	UTSW	16	81490323	missense	probably benign	0.02
R4210:Ncam2	UTSW	16	81527103	missense	probably benign	0.02
R4514:Ncam2	UTSW	16	81512996	missense	probably benign	0.13
R4583:Ncam2	UTSW	16	81517557	missense	probably damaging	1.00
R4586:Ncam2	UTSW	16	81465569	missense	probably benign	0.06
R4710:Ncam2	UTSW	16	81465706	critical splice donor site	probably null
R4732:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4733:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4876:Ncam2	UTSW	16	81490346	missense	probably benign	0.27
R4923:Ncam2	UTSW	16	81589791	missense	possibly damaging	0.48
R5131:Ncam2	UTSW	16	81437662	missense	probably benign	0.44
R5329:Ncam2	UTSW	16	81434819	missense	probably damaging	1.00
R5478:Ncam2	UTSW	16	81434878	nonsense	probably null
R5479:Ncam2	UTSW	16	81434878	nonsense	probably null
R5481:Ncam2	UTSW	16	81434878	nonsense	probably null
R5519:Ncam2	UTSW	16	81434878	nonsense	probably null
R5522:Ncam2	UTSW	16	81434878	nonsense	probably null
R5523:Ncam2	UTSW	16	81434878	nonsense	probably null
R5524:Ncam2	UTSW	16	81434878	nonsense	probably null
R5526:Ncam2	UTSW	16	81434878	nonsense	probably null
R5718:Ncam2	UTSW	16	81589814	splice site	probably null
R5793:Ncam2	UTSW	16	81576103	missense	possibly damaging	0.95
R6050:Ncam2	UTSW	16	81443166	nonsense	probably null
R6212:Ncam2	UTSW	16	81432762	missense	probably damaging	1.00
R6847:Ncam2	UTSW	16	81432718	missense	probably damaging	1.00
R6935:Ncam2	UTSW	16	81526991	missense	probably benign	0.24
R7159:Ncam2	UTSW	16	81490374	missense	probably damaging	1.00
R7193:Ncam2	UTSW	16	81589795	missense	probably damaging	1.00
R7232:Ncam2	UTSW	16	81512871	missense	probably damaging	1.00
R7346:Ncam2	UTSW	16	81623368	missense	probably damaging	1.00
R7568:Ncam2	UTSW	16	81589801	missense	probably benign	0.19
R7686:Ncam2	UTSW	16	81621454	missense	probably damaging	0.99
R7759:Ncam2	UTSW	16	81615784	missense	probably damaging	1.00
R7848:Ncam2	UTSW	16	81490379	missense	probably benign
R8078:Ncam2	UTSW	16	81443248	missense	possibly damaging	0.60
R8287:Ncam2	UTSW	16	81526995	missense	probably benign	0.07
R8429:Ncam2	UTSW	16	81589635	missense	probably damaging	1.00
R8507:Ncam2	UTSW	16	81512979	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- GGGATTAAGTTGCCACTCACTAC -3'
(R):5'- GGCTTAGAAGACAGCCCTAAAC -3'

Sequencing Primer
(F):5'- GTTGCCACTCACTACTCCATATTTTC -3'
(R):5'- GCCCTAAACAATGCATGCAAGTTG -3'

Posted On

2020-08-07