Incidental Mutation 'R7932:Dlgap1'
ID643685
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene NameDLG associated protein 1
SynonymsGKAP/SAPAP, 4933422O14Rik, SAPAP1, Gkap, Sapap1, D17Bwg0511e, DAP-1 beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7932 (G1)
Quality Score999
Status Not validated
Chromosome17
Chromosomal Location69969073-70821413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70516238 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 73 (R73W)
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000146730] [ENSMUST00000155016]
Predicted Effect probably damaging
Transcript: ENSMUST00000060072
AA Change: R73W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279
AA Change: R73W

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133983
AA Change: R73W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279
AA Change: R73W

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135938
AA Change: R73W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279
AA Change: R73W

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146730
AA Change: R73W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: R73W

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155016
AA Change: R73W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279
AA Change: R73W

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,573,180 R666G unknown Het
Adam21 T A 12: 81,560,164 N275Y probably damaging Het
Adam33 G A 2: 131,063,697 probably benign Het
Arhgap24 A T 5: 102,845,969 probably benign Het
Arhgef1 C T 7: 24,919,710 L459F probably damaging Het
Bbx A T 16: 50,210,443 probably null Het
Blk C T 14: 63,373,559 G445S possibly damaging Het
Brca1 T C 11: 101,540,017 E33G possibly damaging Het
Cacna1s T G 1: 136,084,359 L513R probably damaging Het
Cnn3 T A 3: 121,451,429 M98K probably benign Het
Cttnbp2 T A 6: 18,427,533 L716F probably damaging Het
Dnajc4 A G 19: 6,988,270 L182P probably damaging Het
Dock2 T C 11: 34,267,998 M1191V probably benign Het
Fam13a C T 6: 58,983,888 probably null Het
Fbn2 C T 18: 58,020,483 G2569E possibly damaging Het
Fes T C 7: 80,379,872 I623V probably damaging Het
Fyco1 A C 9: 123,828,990 L707R possibly damaging Het
Gadd45b T A 10: 80,930,335 V7E possibly damaging Het
Gm12169 C A 11: 46,535,539 P158T probably benign Het
Gm19410 T A 8: 35,795,599 C897S probably damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Hk1 A G 10: 62,315,520 L31P probably damaging Het
Hoxa4 T G 6: 52,190,417 K261N probably damaging Het
Hrh4 T A 18: 13,015,812 L77* probably null Het
Igf1r A T 7: 68,212,054 I1121F possibly damaging Het
Igkv16-104 A T 6: 68,425,794 I24L probably benign Het
Itk A T 11: 46,340,692 W346R probably benign Het
Kdm2a A G 19: 4,319,156 S1144P probably damaging Het
Krt86 A T 15: 101,476,592 S289C probably damaging Het
Lonrf1 T C 8: 36,222,916 I663V probably benign Het
Lrp2 T G 2: 69,426,027 I4590L probably benign Het
Lrrc8d C T 5: 105,813,025 R434C probably damaging Het
Maneal T C 4: 124,861,845 Y108C probably damaging Het
Myh8 G A 11: 67,294,604 V894I probably benign Het
Ncam2 T G 16: 81,615,820 L732R probably damaging Het
Nsun4 A T 4: 116,044,800 D156E probably damaging Het
Olfr111 T C 17: 37,530,184 I69T probably benign Het
Olfr136 A T 17: 38,335,255 I33L probably benign Het
Olfr1459 A T 19: 13,145,981 M226K probably benign Het
Olfr382 A C 11: 73,517,157 L14R probably damaging Het
Olfr419 T C 1: 174,250,694 I78V probably benign Het
Olfr798 C A 10: 129,625,225 V279F probably damaging Het
P2rx7 G A 5: 122,644,182 V37I probably benign Het
Pcdh15 A G 10: 74,645,527 R235G probably benign Het
Pcdhga1 T C 18: 37,663,460 S506P probably damaging Het
Pira2 A T 7: 3,842,436 probably null Het
Plch1 A G 3: 63,701,981 V935A probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prpf8 A G 11: 75,492,597 D607G possibly damaging Het
Ptdss1 T C 13: 66,966,432 W215R probably damaging Het
Ptpn9 C A 9: 57,036,616 P258Q possibly damaging Het
Rfpl4b A G 10: 38,821,350 V85A possibly damaging Het
Sacs C A 14: 61,204,878 Q1458K probably damaging Het
Scfd2 A T 5: 74,531,550 S24T probably benign Het
Siae A G 9: 37,633,684 D325G probably benign Het
Slc22a23 C A 13: 34,182,977 A683S probably damaging Het
Slc44a3 A T 3: 121,512,360 I244N possibly damaging Het
Srrm2 T A 17: 23,818,527 S1382T probably benign Het
Tfap2c A G 2: 172,551,786 Y207C probably damaging Het
Tnc T C 4: 64,008,620 I890V probably benign Het
Trim30a A T 7: 104,429,338 I177N probably benign Het
Tshz2 T A 2: 169,886,331 M949K possibly damaging Het
Ttn T G 2: 76,725,186 T30492P probably damaging Het
Ubb C T 11: 62,552,785 Q214* probably null Het
Ulk2 A G 11: 61,808,090 S423P probably benign Het
Vmn1r237 C A 17: 21,314,463 D149E probably benign Het
Zbtb24 A G 10: 41,451,508 D130G probably benign Het
Zfp689 C A 7: 127,444,351 G369V probably damaging Het
Zg16 A G 7: 127,050,405 F128S probably damaging Het
Zmym1 T G 4: 127,050,785 N203T possibly damaging Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70516085 missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70516074 missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70516379 missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70516034 missense probably damaging 1.00
BB009:Dlgap1 UTSW 17 70516238 missense probably damaging 1.00
BB019:Dlgap1 UTSW 17 70516238 missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 70761346 missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70516190 missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70516994 nonsense probably null
R1951:Dlgap1 UTSW 17 70761311 missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70662770 missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 70786831 nonsense probably null
R3438:Dlgap1 UTSW 17 70516361 missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 70718226 critical splice donor site probably null
R3881:Dlgap1 UTSW 17 70786815 missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70516785 missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 70761080 missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 70766043 missense probably benign
R4273:Dlgap1 UTSW 17 70766043 missense probably benign
R4557:Dlgap1 UTSW 17 70516689 missense probably benign 0.01
R4652:Dlgap1 UTSW 17 70761095 missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70593380 nonsense probably null
R5000:Dlgap1 UTSW 17 70766058 missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 70718227 critical splice donor site probably null
R5291:Dlgap1 UTSW 17 70718210 missense probably benign 0.03
R5304:Dlgap1 UTSW 17 70815207 missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70517030 intron probably benign
R5522:Dlgap1 UTSW 17 70516998 critical splice donor site probably null
R5586:Dlgap1 UTSW 17 70818161 missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 70718199 missense probably benign
R5802:Dlgap1 UTSW 17 70766091 critical splice donor site probably null
R5850:Dlgap1 UTSW 17 70787092 missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 70815393 intron probably benign
R5883:Dlgap1 UTSW 17 70517013 intron probably benign
R6045:Dlgap1 UTSW 17 70818098 missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 70815289 missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70593330 missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 70787123 missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 70818074 missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70662758 missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70516098 missense possibly damaging 0.93
R7382:Dlgap1 UTSW 17 70787174 missense probably damaging 1.00
R7859:Dlgap1 UTSW 17 70516688 missense probably benign
R8477:Dlgap1 UTSW 17 70516972 missense probably damaging 1.00
T0975:Dlgap1 UTSW 17 70516955 missense possibly damaging 0.86
Z1176:Dlgap1 UTSW 17 70815209 missense probably damaging 1.00
Z1177:Dlgap1 UTSW 17 70662743 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAAGGGTTATCGGGTAGCC -3'
(R):5'- TAAAGAGCTTCTGGACCGAGTG -3'

Sequencing Primer
(F):5'- ACCATGGGATCACCTGCGAG -3'
(R):5'- TATCGCTGCGATGCTCCACAG -3'
Posted On2020-08-07