Incidental Mutation 'R7932:Dnajc4'
ID643690
Institutional Source Beutler Lab
Gene Symbol Dnajc4
Ensembl Gene ENSMUSG00000024963
Gene NameDnaJ heat shock protein family (Hsp40) member C4
SynonymsHspf2, 2010301J22Rik, Mcg18
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7932 (G1)
Quality Score999
Status Not validated
Chromosome19
Chromosomal Location6987911-6992503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6988270 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 182 (L182P)
Ref Sequence ENSEMBL: ENSMUSP00000025915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025914] [ENSMUST00000025915] [ENSMUST00000041686] [ENSMUST00000130048] [ENSMUST00000179118] [ENSMUST00000180765]
Predicted Effect probably benign
Transcript: ENSMUST00000025914
SMART Domains Protein: ENSMUSP00000025914
Gene: ENSMUSG00000024962

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
low complexity region 182 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000025915
AA Change: L182P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025915
Gene: ENSMUSG00000024963
AA Change: L182P

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 160 179 N/A INTRINSIC
low complexity region 205 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041686
SMART Domains Protein: ENSMUSP00000041419
Gene: ENSMUSG00000037349

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130048
SMART Domains Protein: ENSMUSP00000120860
Gene: ENSMUSG00000024962

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
Pfam:VEGF_C 134 188 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179118
AA Change: L181P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136062
Gene: ENSMUSG00000024963
AA Change: L181P

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 159 178 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180765
SMART Domains Protein: ENSMUSP00000137738
Gene: ENSMUSG00000037349

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,573,180 R666G unknown Het
Adam21 T A 12: 81,560,164 N275Y probably damaging Het
Adam33 G A 2: 131,063,697 probably benign Het
Arhgap24 A T 5: 102,845,969 probably benign Het
Arhgef1 C T 7: 24,919,710 L459F probably damaging Het
Bbx A T 16: 50,210,443 probably null Het
Blk C T 14: 63,373,559 G445S possibly damaging Het
Brca1 T C 11: 101,540,017 E33G possibly damaging Het
Cacna1s T G 1: 136,084,359 L513R probably damaging Het
Cnn3 T A 3: 121,451,429 M98K probably benign Het
Cttnbp2 T A 6: 18,427,533 L716F probably damaging Het
Dlgap1 A T 17: 70,516,238 R73W probably damaging Het
Dock2 T C 11: 34,267,998 M1191V probably benign Het
Fam13a C T 6: 58,983,888 probably null Het
Fbn2 C T 18: 58,020,483 G2569E possibly damaging Het
Fes T C 7: 80,379,872 I623V probably damaging Het
Fyco1 A C 9: 123,828,990 L707R possibly damaging Het
Gadd45b T A 10: 80,930,335 V7E possibly damaging Het
Gm12169 C A 11: 46,535,539 P158T probably benign Het
Gm19410 T A 8: 35,795,599 C897S probably damaging Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
Hk1 A G 10: 62,315,520 L31P probably damaging Het
Hoxa4 T G 6: 52,190,417 K261N probably damaging Het
Hrh4 T A 18: 13,015,812 L77* probably null Het
Igf1r A T 7: 68,212,054 I1121F possibly damaging Het
Igkv16-104 A T 6: 68,425,794 I24L probably benign Het
Itk A T 11: 46,340,692 W346R probably benign Het
Kdm2a A G 19: 4,319,156 S1144P probably damaging Het
Krt86 A T 15: 101,476,592 S289C probably damaging Het
Lonrf1 T C 8: 36,222,916 I663V probably benign Het
Lrp2 T G 2: 69,426,027 I4590L probably benign Het
Lrrc8d C T 5: 105,813,025 R434C probably damaging Het
Maneal T C 4: 124,861,845 Y108C probably damaging Het
Myh8 G A 11: 67,294,604 V894I probably benign Het
Ncam2 T G 16: 81,615,820 L732R probably damaging Het
Nsun4 A T 4: 116,044,800 D156E probably damaging Het
Olfr111 T C 17: 37,530,184 I69T probably benign Het
Olfr136 A T 17: 38,335,255 I33L probably benign Het
Olfr1459 A T 19: 13,145,981 M226K probably benign Het
Olfr382 A C 11: 73,517,157 L14R probably damaging Het
Olfr419 T C 1: 174,250,694 I78V probably benign Het
Olfr798 C A 10: 129,625,225 V279F probably damaging Het
P2rx7 G A 5: 122,644,182 V37I probably benign Het
Pcdh15 A G 10: 74,645,527 R235G probably benign Het
Pcdhga1 T C 18: 37,663,460 S506P probably damaging Het
Pira2 A T 7: 3,842,436 probably null Het
Plch1 A G 3: 63,701,981 V935A probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prpf8 A G 11: 75,492,597 D607G possibly damaging Het
Ptdss1 T C 13: 66,966,432 W215R probably damaging Het
Ptpn9 C A 9: 57,036,616 P258Q possibly damaging Het
Rfpl4b A G 10: 38,821,350 V85A possibly damaging Het
Sacs C A 14: 61,204,878 Q1458K probably damaging Het
Scfd2 A T 5: 74,531,550 S24T probably benign Het
Siae A G 9: 37,633,684 D325G probably benign Het
Slc22a23 C A 13: 34,182,977 A683S probably damaging Het
Slc44a3 A T 3: 121,512,360 I244N possibly damaging Het
Srrm2 T A 17: 23,818,527 S1382T probably benign Het
Tfap2c A G 2: 172,551,786 Y207C probably damaging Het
Tnc T C 4: 64,008,620 I890V probably benign Het
Trim30a A T 7: 104,429,338 I177N probably benign Het
Tshz2 T A 2: 169,886,331 M949K possibly damaging Het
Ttn T G 2: 76,725,186 T30492P probably damaging Het
Ubb C T 11: 62,552,785 Q214* probably null Het
Ulk2 A G 11: 61,808,090 S423P probably benign Het
Vmn1r237 C A 17: 21,314,463 D149E probably benign Het
Zbtb24 A G 10: 41,451,508 D130G probably benign Het
Zfp689 C A 7: 127,444,351 G369V probably damaging Het
Zg16 A G 7: 127,050,405 F128S probably damaging Het
Zmym1 T G 4: 127,050,785 N203T possibly damaging Het
Other mutations in Dnajc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Dnajc4 APN 19 6989501 missense probably benign
IGL02500:Dnajc4 APN 19 6988088 missense possibly damaging 0.72
IGL02930:Dnajc4 APN 19 6989433 missense possibly damaging 0.92
BB009:Dnajc4 UTSW 19 6988270 missense probably damaging 1.00
BB019:Dnajc4 UTSW 19 6988270 missense probably damaging 1.00
R2509:Dnajc4 UTSW 19 6990743 missense probably damaging 1.00
R4157:Dnajc4 UTSW 19 6989840 missense probably damaging 1.00
R4747:Dnajc4 UTSW 19 6989504 missense probably damaging 0.99
R6060:Dnajc4 UTSW 19 6990725 nonsense probably null
R8752:Dnajc4 UTSW 19 6989433 missense probably benign 0.08
Predicted Primers
Posted On2020-08-07