Incidental Mutation 'R7933:Dnajc7'
ID 643717
Institutional Source Beutler Lab
Gene Symbol Dnajc7
Ensembl Gene ENSMUSG00000014195
Gene Name DnaJ heat shock protein family (Hsp40) member C7
Synonyms mTpr2, Ttc2, 2010003F24Rik, mDj11, 2010004G07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_019795; MGI: 1928373

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7933 (G1)
Quality Score 999
Status Validated
Chromosome 11
Chromosomal Location 100582818-100620168 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100596212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 145 (Y145C)
Ref Sequence ENSEMBL: ENSMUSP00000014339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000146840]
AlphaFold Q9QYI3
Predicted Effect probably damaging
Transcript: ENSMUST00000014339
AA Change: Y145C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195
AA Change: Y145C

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146840
AA Change: Y129C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115438
Gene: ENSMUSG00000014195
AA Change: Y129C

DomainStartEndE-ValueType
TPR 12 45 3.39e-7 SMART
TPR 46 79 1.11e-2 SMART
TPR 80 113 4.09e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116793
Gene: ENSMUSG00000014195
AA Change: Y97C

DomainStartEndE-ValueType
TPR 19 52 3.39e-7 SMART
TPR 53 86 1.11e-2 SMART
Blast:TPR 95 128 1e-13 BLAST
Blast:TPR 129 162 3e-14 BLAST
TPR 163 196 2.29e-4 SMART
TPR 209 242 1.11e-2 SMART
Meta Mutation Damage Score 0.1770 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the chaperone proteins heat shock proteins 70 and 90 in an ATP-dependent manner and may function as a co-chaperone. Pseudogenes of this gene are found on chromosomes 1 and 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit hepatic steatosis and increased serum cholesterol. [provided by MGI curators]
Allele List at MGI

All alleles(178) : Targeted, other(2) Gene trapped(176)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Agap2 C A 10: 127,086,920 probably benign Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Ankrd27 A G 7: 35,601,649 probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Bbs1 T A 19: 4,891,650 probably benign Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Olfr980 T C 9: 40,007,135 probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp169 A G 13: 48,490,481 V390A unknown Het
Other mutations in Dnajc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Dnajc7 APN 11 100599191 missense possibly damaging 0.90
IGL00924:Dnajc7 APN 11 100584285 missense possibly damaging 0.81
3-1:Dnajc7 UTSW 11 100589957 missense probably damaging 1.00
BB010:Dnajc7 UTSW 11 100596212 missense probably damaging 0.98
BB020:Dnajc7 UTSW 11 100596212 missense probably damaging 0.98
R1282:Dnajc7 UTSW 11 100584641 missense probably damaging 1.00
R1587:Dnajc7 UTSW 11 100601730 missense probably damaging 1.00
R1874:Dnajc7 UTSW 11 100599313 splice site probably benign
R1985:Dnajc7 UTSW 11 100590892 missense probably benign 0.11
R4020:Dnajc7 UTSW 11 100591466 missense probably damaging 0.96
R4065:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4067:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4611:Dnajc7 UTSW 11 100590977 nonsense probably null
R4687:Dnajc7 UTSW 11 100599300 missense probably damaging 1.00
R4716:Dnajc7 UTSW 11 100619576 missense probably benign
R7469:Dnajc7 UTSW 11 100591551 missense probably benign
R7740:Dnajc7 UTSW 11 100591561 missense probably benign 0.01
R7842:Dnajc7 UTSW 11 100598718 missense probably benign 0.42
R7886:Dnajc7 UTSW 11 100601803 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATAGCCAACGGGAATATAAGC -3'
(R):5'- CTGGGTTTCTAGATCAGGTCTC -3'

Sequencing Primer
(F):5'- CGGGAATATAAGCAAGCTGATTTTTG -3'
(R):5'- CTGGAACTCACTATGTAGTTCAGGC -3'
Posted On 2020-08-07