Incidental Mutation 'R7933:Eml5'
ID 643718
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 045979-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R7933 (G1)
Quality Score 999
Status Validated
Chromosome 12
Chromosomal Location 98753064-98867743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 98810279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 892 (D892E)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: D853E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: D853E

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000223282
AA Change: D892E

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A G 11: 50,833,227 (GRCm39) V125A unknown Het
Adam34 T A 8: 44,103,911 (GRCm39) H578L probably damaging Het
Agap2 C A 10: 126,922,789 (GRCm39) probably benign Het
Ago4 A T 4: 126,400,811 (GRCm39) M678K probably benign Het
Ankrd27 A G 7: 35,301,074 (GRCm39) probably benign Het
Atosb A T 4: 43,035,919 (GRCm39) C271S probably benign Het
Atrn T C 2: 130,836,986 (GRCm39) L1150P probably damaging Het
Bbs1 T A 19: 4,941,678 (GRCm39) probably benign Het
Camta1 C T 4: 151,168,214 (GRCm39) E279K probably damaging Het
Ccdc88c T C 12: 100,911,749 (GRCm39) D695G possibly damaging Het
Col11a2 A T 17: 34,275,029 (GRCm39) K400* probably null Het
Cpsf4 T A 5: 145,104,168 (GRCm39) M1K probably null Het
Dnah12 A T 14: 26,488,072 (GRCm39) Q992L probably benign Het
Dnajc7 T C 11: 100,487,038 (GRCm39) Y145C probably damaging Het
Fam193a A G 5: 34,623,539 (GRCm39) K23E possibly damaging Het
Filip1 T G 9: 79,727,329 (GRCm39) K430T possibly damaging Het
Gm5089 T C 14: 122,673,403 (GRCm39) D106G unknown Het
Hip1 A T 5: 135,489,310 (GRCm39) N45K probably damaging Het
Hivep2 T C 10: 14,003,581 (GRCm39) S60P probably damaging Het
Ighv1-53 A T 12: 115,122,029 (GRCm39) C115* probably null Het
Macf1 T C 4: 123,303,444 (GRCm39) T353A probably benign Het
Mast3 A T 8: 71,239,279 (GRCm39) V433E probably damaging Het
Mast4 A T 13: 102,909,071 (GRCm39) M660K probably damaging Het
Nr2e1 T C 10: 42,439,379 (GRCm39) Y380C probably damaging Het
Or10g9b T C 9: 39,918,431 (GRCm39) probably benign Het
Or5b111 T A 19: 13,291,569 (GRCm39) M27L probably benign Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
Slc6a1 T A 6: 114,288,859 (GRCm39) W473R probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata31d1e A G 13: 59,891,565 (GRCm39) L85P probably damaging Het
Sprr3 T C 3: 92,364,515 (GRCm39) I110V possibly damaging Het
Ston1 A G 17: 88,943,572 (GRCm39) E326G probably benign Het
Tapbpl T G 6: 125,207,233 (GRCm39) Q152P probably damaging Het
Tectb C T 19: 55,183,105 (GRCm39) L319F possibly damaging Het
Tpp2 G A 1: 44,000,121 (GRCm39) G413D probably damaging Het
Tpsg1 A G 17: 25,592,178 (GRCm39) H84R probably damaging Het
Usp24 A G 4: 106,285,686 (GRCm39) N2437S probably benign Het
Usp32 T C 11: 84,897,885 (GRCm39) Q1152R probably damaging Het
Vmn2r6 T C 3: 64,467,224 (GRCm39) T92A probably benign Het
Xpo7 A G 14: 70,944,788 (GRCm39) V35A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zfp169 A G 13: 48,643,957 (GRCm39) V390A unknown Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98,839,468 (GRCm39) splice site probably benign
IGL00473:Eml5 APN 12 98,771,751 (GRCm39) splice site probably benign
IGL01120:Eml5 APN 12 98,810,278 (GRCm39) missense probably benign
IGL01308:Eml5 APN 12 98,768,572 (GRCm39) missense probably damaging 1.00
IGL01790:Eml5 APN 12 98,765,191 (GRCm39) missense probably damaging 1.00
IGL01973:Eml5 APN 12 98,829,539 (GRCm39) missense probably benign
IGL02182:Eml5 APN 12 98,768,581 (GRCm39) missense probably damaging 1.00
IGL02201:Eml5 APN 12 98,760,683 (GRCm39) splice site probably benign
IGL02375:Eml5 APN 12 98,810,346 (GRCm39) missense probably damaging 1.00
IGL02397:Eml5 APN 12 98,756,933 (GRCm39) missense probably benign 0.07
IGL02480:Eml5 APN 12 98,842,502 (GRCm39) missense probably damaging 1.00
IGL02801:Eml5 APN 12 98,784,104 (GRCm39) missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98,825,100 (GRCm39) missense probably damaging 1.00
IGL03104:Eml5 APN 12 98,827,504 (GRCm39) nonsense probably null
IGL03158:Eml5 APN 12 98,793,773 (GRCm39) splice site probably benign
IGL03286:Eml5 APN 12 98,826,762 (GRCm39) missense probably damaging 1.00
IGL03380:Eml5 APN 12 98,840,906 (GRCm39) splice site probably benign
BB010:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98,791,031 (GRCm39) splice site probably null
R0624:Eml5 UTSW 12 98,831,738 (GRCm39) missense probably damaging 1.00
R0993:Eml5 UTSW 12 98,827,442 (GRCm39) missense probably benign 0.25
R1073:Eml5 UTSW 12 98,797,232 (GRCm39) missense probably damaging 1.00
R1183:Eml5 UTSW 12 98,758,305 (GRCm39) missense probably benign 0.31
R1352:Eml5 UTSW 12 98,797,262 (GRCm39) splice site probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1503:Eml5 UTSW 12 98,797,433 (GRCm39) missense probably damaging 0.99
R1538:Eml5 UTSW 12 98,760,535 (GRCm39) missense probably damaging 0.99
R1689:Eml5 UTSW 12 98,797,194 (GRCm39) missense probably damaging 1.00
R1773:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1775:Eml5 UTSW 12 98,818,963 (GRCm39) splice site probably null
R1791:Eml5 UTSW 12 98,853,315 (GRCm39) missense probably benign 0.31
R1856:Eml5 UTSW 12 98,776,843 (GRCm39) missense probably damaging 1.00
R1919:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1957:Eml5 UTSW 12 98,826,220 (GRCm39) missense probably damaging 1.00
R1962:Eml5 UTSW 12 98,842,570 (GRCm39) missense probably damaging 0.99
R2033:Eml5 UTSW 12 98,757,645 (GRCm39) missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98,760,525 (GRCm39) missense probably benign 0.33
R2073:Eml5 UTSW 12 98,768,705 (GRCm39) missense probably damaging 0.99
R2143:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2144:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2158:Eml5 UTSW 12 98,810,205 (GRCm39) splice site probably benign
R2164:Eml5 UTSW 12 98,853,356 (GRCm39) missense probably damaging 0.99
R2175:Eml5 UTSW 12 98,842,482 (GRCm39) nonsense probably null
R2200:Eml5 UTSW 12 98,791,676 (GRCm39) missense probably damaging 1.00
R2234:Eml5 UTSW 12 98,807,840 (GRCm39) missense probably damaging 1.00
R2504:Eml5 UTSW 12 98,810,364 (GRCm39) missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2958:Eml5 UTSW 12 98,842,437 (GRCm39) missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98,847,067 (GRCm39) splice site probably null
R3118:Eml5 UTSW 12 98,831,753 (GRCm39) missense probably damaging 0.97
R3735:Eml5 UTSW 12 98,822,248 (GRCm39) missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98,782,283 (GRCm39) missense probably damaging 1.00
R3900:Eml5 UTSW 12 98,791,782 (GRCm39) missense probably damaging 1.00
R3973:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R3976:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R4105:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4107:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4108:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4109:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4258:Eml5 UTSW 12 98,831,693 (GRCm39) missense probably benign 0.01
R4381:Eml5 UTSW 12 98,782,214 (GRCm39) missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98,803,600 (GRCm39) missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98,765,111 (GRCm39) missense probably damaging 1.00
R4775:Eml5 UTSW 12 98,768,566 (GRCm39) missense probably benign 0.05
R4850:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5007:Eml5 UTSW 12 98,797,224 (GRCm39) missense probably damaging 1.00
R5092:Eml5 UTSW 12 98,758,875 (GRCm39) missense probably damaging 1.00
R5123:Eml5 UTSW 12 98,840,771 (GRCm39) missense probably damaging 1.00
R5124:Eml5 UTSW 12 98,758,301 (GRCm39) missense probably damaging 1.00
R5273:Eml5 UTSW 12 98,756,947 (GRCm39) missense probably damaging 1.00
R5369:Eml5 UTSW 12 98,825,042 (GRCm39) missense probably damaging 1.00
R5430:Eml5 UTSW 12 98,760,417 (GRCm39) missense probably damaging 1.00
R5748:Eml5 UTSW 12 98,791,814 (GRCm39) missense probably damaging 0.99
R5769:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5832:Eml5 UTSW 12 98,842,447 (GRCm39) missense probably benign
R6113:Eml5 UTSW 12 98,790,933 (GRCm39) nonsense probably null
R6131:Eml5 UTSW 12 98,827,510 (GRCm39) missense probably damaging 0.99
R6175:Eml5 UTSW 12 98,760,715 (GRCm39) missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98,829,388 (GRCm39) missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98,837,143 (GRCm39) missense probably damaging 0.98
R6375:Eml5 UTSW 12 98,765,127 (GRCm39)
R6528:Eml5 UTSW 12 98,790,896 (GRCm39) missense probably benign 0.18
R6657:Eml5 UTSW 12 98,757,664 (GRCm39) missense probably damaging 0.98
R6717:Eml5 UTSW 12 98,793,765 (GRCm39) missense probably damaging 1.00
R6751:Eml5 UTSW 12 98,831,659 (GRCm39) missense probably damaging 1.00
R6833:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6834:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6972:Eml5 UTSW 12 98,842,439 (GRCm39) missense probably benign 0.00
R7091:Eml5 UTSW 12 98,768,733 (GRCm39) missense probably benign 0.16
R7353:Eml5 UTSW 12 98,791,683 (GRCm39) missense
R7644:Eml5 UTSW 12 98,822,203 (GRCm39) missense probably benign 0.05
R7694:Eml5 UTSW 12 98,758,822 (GRCm39) missense probably damaging 0.99
R7842:Eml5 UTSW 12 98,760,394 (GRCm39) missense probably damaging 1.00
R8111:Eml5 UTSW 12 98,758,773 (GRCm39) critical splice donor site probably null
R8198:Eml5 UTSW 12 98,825,145 (GRCm39) nonsense probably null
R8482:Eml5 UTSW 12 98,842,560 (GRCm39) missense probably damaging 1.00
R8732:Eml5 UTSW 12 98,782,218 (GRCm39) missense probably damaging 0.99
R8956:Eml5 UTSW 12 98,818,952 (GRCm39) missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98,776,829 (GRCm39) missense probably damaging 0.99
R9131:Eml5 UTSW 12 98,825,099 (GRCm39) missense probably damaging 1.00
R9258:Eml5 UTSW 12 98,810,376 (GRCm39) missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98,822,287 (GRCm39) missense probably damaging 0.99
R9276:Eml5 UTSW 12 98,765,060 (GRCm39) missense probably damaging 0.99
R9301:Eml5 UTSW 12 98,848,292 (GRCm39) nonsense probably null
R9368:Eml5 UTSW 12 98,762,837 (GRCm39) missense probably benign 0.31
R9392:Eml5 UTSW 12 98,867,199 (GRCm39) missense probably damaging 1.00
R9393:Eml5 UTSW 12 98,842,433 (GRCm39) missense probably benign 0.35
R9449:Eml5 UTSW 12 98,827,554 (GRCm39) missense probably damaging 1.00
R9570:Eml5 UTSW 12 98,782,243 (GRCm39) missense probably benign 0.15
T0722:Eml5 UTSW 12 98,807,841 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCATATTTAGGGATTTGGAAGGAGA -3'
(R):5'- AACTGTTCTTTGTAACTGTGGACA -3'

Sequencing Primer
(F):5'- AGAGAACAAAACAGACCATGATTG -3'
(R):5'- CTGTGGACATTTTGAAAGCAGTAC -3'
Posted On 2020-08-07