Incidental Mutation 'R7933:Zfp169'
ID643721
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Namezinc finger protein 169
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7933 (G1)
Quality Score999
Status Validated
Chromosome13
Chromosomal Location48487647-48513451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48490481 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 390 (V390A)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: V390A
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: V390A

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: V390A
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: V390A

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Meta Mutation Damage Score 0.1933 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,751 L85P probably damaging Het
4933414I15Rik A G 11: 50,942,400 V125A unknown Het
Adam34 T A 8: 43,650,874 H578L probably damaging Het
Agap2 C A 10: 127,086,920 probably benign Het
Ago4 A T 4: 126,507,018 M678K probably benign Het
Ankrd27 A G 7: 35,601,649 probably benign Het
Atrn T C 2: 130,995,066 L1150P probably damaging Het
Bbs1 T A 19: 4,891,650 probably benign Het
Camta1 C T 4: 151,083,757 E279K probably damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Col11a2 A T 17: 34,056,055 K400* probably null Het
Cpsf4 T A 5: 145,167,358 M1K probably null Het
Dnah12 A T 14: 26,766,115 Q992L probably benign Het
Dnajc7 T C 11: 100,596,212 Y145C probably damaging Het
Eml5 A T 12: 98,844,020 D892E possibly damaging Het
Fam193a A G 5: 34,466,195 K23E possibly damaging Het
Fam214b A T 4: 43,035,919 C271S probably benign Het
Filip1 T G 9: 79,820,047 K430T possibly damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Hip1 A T 5: 135,460,456 N45K probably damaging Het
Hivep2 T C 10: 14,127,837 S60P probably damaging Het
Ighv1-53 A T 12: 115,158,409 C115* probably null Het
Macf1 T C 4: 123,409,651 T353A probably benign Het
Mast3 A T 8: 70,786,635 V433E probably damaging Het
Mast4 A T 13: 102,772,563 M660K probably damaging Het
Nr2e1 T C 10: 42,563,383 Y380C probably damaging Het
Olfr1465 T A 19: 13,314,205 M27L probably benign Het
Olfr980 T C 9: 40,007,135 probably benign Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Slc6a1 T A 6: 114,311,898 W473R probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sprr3 T C 3: 92,457,208 I110V possibly damaging Het
Ston1 A G 17: 88,636,144 E326G probably benign Het
Tapbpl T G 6: 125,230,270 Q152P probably damaging Het
Tectb C T 19: 55,194,673 L319F possibly damaging Het
Tpp2 G A 1: 43,960,961 G413D probably damaging Het
Tpsg1 A G 17: 25,373,204 H84R probably damaging Het
Usp24 A G 4: 106,428,489 N2437S probably benign Het
Usp32 T C 11: 85,007,059 Q1152R probably damaging Het
Vmn2r6 T C 3: 64,559,803 T92A probably benign Het
Xpo7 A G 14: 70,707,348 V35A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48490481 missense unknown
BB020:Zfp169 UTSW 13 48490481 missense unknown
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48489996 missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7679:Zfp169 UTSW 13 48498383 missense probably damaging 0.99
R8298:Zfp169 UTSW 13 48498377 nonsense probably null
R8322:Zfp169 UTSW 13 48491099 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGGGCATAGGAAAGGTTTTACC -3'
(R):5'- TCCGCCAGAAGATAGACCTC -3'

Sequencing Primer
(F):5'- ACCTCTGTGTGAATCCTCTGGTG -3'
(R):5'- GCCAGAAGATAGACCTCCTCCTC -3'
Posted On2020-08-07