Incidental Mutation 'R0057:Gna11'
ID64374
Institutional Source Beutler Lab
Gene Symbol Gna11
Ensembl Gene ENSMUSG00000034781
Gene Nameguanine nucleotide binding protein, alpha 11
SynonymsDsk7
MMRRC Submission 038351-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0057 (G1)
Quality Score99
Status Validated
Chromosome10
Chromosomal Location81528724-81545190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81530940 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 312 (M312T)
Ref Sequence ENSEMBL: ENSMUSP00000043190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043604]
Predicted Effect probably benign
Transcript: ENSMUST00000043604
AA Change: M312T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043190
Gene: ENSMUSG00000034781
AA Change: M312T

DomainStartEndE-ValueType
G_alpha 19 358 3.09e-208 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218454
Meta Mutation Damage Score 0.1652 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice deficient for this gene do not exhibit any detectable abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,570,919 H693Q probably damaging Het
Ap5z1 T C 5: 142,470,389 probably benign Het
Bloc1s6 T A 2: 122,744,221 probably benign Het
Caskin1 A G 17: 24,504,896 N886S probably damaging Het
Ctse G T 1: 131,663,371 D97Y probably damaging Het
Dcaf11 T C 14: 55,569,310 V490A probably benign Het
Dctn1 A G 6: 83,179,892 H7R probably benign Het
Dscam A C 16: 96,673,736 W1209G probably damaging Het
Fuk C T 8: 110,893,768 probably benign Het
Hacd2 T A 16: 35,075,627 V105D probably damaging Het
Htra4 C A 8: 25,038,808 V23L probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Msh4 C T 3: 153,869,681 A686T probably benign Het
Nbas T A 12: 13,390,957 M1096K probably benign Het
Olfr1022 C A 2: 85,869,253 Y220* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prlr A G 15: 10,328,423 Y328C probably damaging Het
Ros1 C T 10: 52,180,191 V68I probably benign Het
Shmt2 G A 10: 127,521,048 T31M possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tas2r135 A G 6: 42,406,420 T298A probably benign Het
Tmem175 C T 5: 108,639,562 H92Y probably damaging Het
Top3a C T 11: 60,740,684 A951T probably benign Het
Trpc4ap T C 2: 155,640,486 E528G possibly damaging Het
Trpm6 T C 19: 18,786,755 C242R probably benign Het
Vwa7 G A 17: 35,024,547 S710N possibly damaging Het
Zfa-ps A T 10: 52,545,106 noncoding transcript Het
Zfp770 T A 2: 114,197,232 R119* probably null Het
Other mutations in Gna11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Gna11 APN 10 81530884 missense probably damaging 1.00
IGL02972:Gna11 APN 10 81533391 missense probably benign
IGL03290:Gna11 APN 10 81530937 missense probably damaging 1.00
R0057:Gna11 UTSW 10 81530940 missense probably benign 0.19
R0417:Gna11 UTSW 10 81530904 missense probably damaging 1.00
R1542:Gna11 UTSW 10 81533328 missense probably benign
R1957:Gna11 UTSW 10 81530844 missense probably damaging 1.00
R5180:Gna11 UTSW 10 81544873 missense probably benign 0.01
R5534:Gna11 UTSW 10 81531133 missense probably damaging 1.00
R5967:Gna11 UTSW 10 81530809 missense probably benign 0.11
R6445:Gna11 UTSW 10 81533333 missense probably damaging 1.00
R6523:Gna11 UTSW 10 81544854 missense probably damaging 1.00
R7450:Gna11 UTSW 10 81532522 missense
R7556:Gna11 UTSW 10 81531374 missense
Predicted Primers PCR Primer
(F):5'- AGGGCACACTGCTGTTCATGTATC -3'
(R):5'- ACAAGATCCTGCACTCACACTTGG -3'

Sequencing Primer
(F):5'- TCAAGCCACATTGAGTCAAGG -3'
(R):5'- GTCGATTACTTCCCTGAGTTTGATG -3'
Posted On2013-08-06