Incidental Mutation 'R0057:Snapc1'
ID64376
Institutional Source Beutler Lab
Gene Symbol Snapc1
Ensembl Gene ENSMUSG00000021113
Gene Namesmall nuclear RNA activating complex, polypeptide 1
Synonyms2700033G17Rik
MMRRC Submission 038351-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0057 (G1)
Quality Score198
Status Validated
Chromosome12
Chromosomal Location73964481-73988966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73975032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 81 (R81C)
Ref Sequence ENSEMBL: ENSMUSP00000152248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000220882] [ENSMUST00000221556]
Predicted Effect probably damaging
Transcript: ENSMUST00000021532
AA Change: R302C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: R302C

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SNAPc_SNAP43 26 210 4.5e-65 PFAM
low complexity region 261 273 N/A INTRINSIC
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220882
AA Change: R81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000220909
AA Change: R48C
Predicted Effect probably benign
Transcript: ENSMUST00000221556
Meta Mutation Damage Score 0.2723 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,570,919 H693Q probably damaging Het
Ap5z1 T C 5: 142,470,389 probably benign Het
Bloc1s6 T A 2: 122,744,221 probably benign Het
Caskin1 A G 17: 24,504,896 N886S probably damaging Het
Ctse G T 1: 131,663,371 D97Y probably damaging Het
Dcaf11 T C 14: 55,569,310 V490A probably benign Het
Dctn1 A G 6: 83,179,892 H7R probably benign Het
Dscam A C 16: 96,673,736 W1209G probably damaging Het
Fuk C T 8: 110,893,768 probably benign Het
Gna11 A G 10: 81,530,940 M312T probably benign Het
Hacd2 T A 16: 35,075,627 V105D probably damaging Het
Htra4 C A 8: 25,038,808 V23L probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Msh4 C T 3: 153,869,681 A686T probably benign Het
Nbas T A 12: 13,390,957 M1096K probably benign Het
Olfr1022 C A 2: 85,869,253 Y220* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prlr A G 15: 10,328,423 Y328C probably damaging Het
Ros1 C T 10: 52,180,191 V68I probably benign Het
Shmt2 G A 10: 127,521,048 T31M possibly damaging Het
Tas2r135 A G 6: 42,406,420 T298A probably benign Het
Tmem175 C T 5: 108,639,562 H92Y probably damaging Het
Top3a C T 11: 60,740,684 A951T probably benign Het
Trpc4ap T C 2: 155,640,486 E528G possibly damaging Het
Trpm6 T C 19: 18,786,755 C242R probably benign Het
Vwa7 G A 17: 35,024,547 S710N possibly damaging Het
Zfa-ps A T 10: 52,545,106 noncoding transcript Het
Zfp770 T A 2: 114,197,232 R119* probably null Het
Other mutations in Snapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Snapc1 APN 12 73968374 splice site probably null
IGL00529:Snapc1 APN 12 73964655 missense probably benign 0.00
IGL00676:Snapc1 APN 12 73971913 missense probably damaging 1.00
IGL01373:Snapc1 APN 12 73964680 missense probably benign 0.00
IGL02060:Snapc1 APN 12 73968036 missense probably damaging 1.00
IGL02309:Snapc1 APN 12 73968027 missense probably damaging 1.00
IGL02653:Snapc1 APN 12 73982487 missense probably benign 0.00
IGL02686:Snapc1 APN 12 73964596 intron probably benign
IGL03160:Snapc1 APN 12 73970204 missense probably damaging 1.00
PIT4362001:Snapc1 UTSW 12 73982495 missense probably damaging 0.98
R0056:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0113:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0152:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0153:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0244:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0245:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0316:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0318:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0352:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0646:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0841:Snapc1 UTSW 12 73975006 splice site probably benign
R2188:Snapc1 UTSW 12 73970227 missense probably damaging 1.00
R2483:Snapc1 UTSW 12 73964643 missense probably benign 0.02
R4165:Snapc1 UTSW 12 73982580 critical splice donor site probably null
R4169:Snapc1 UTSW 12 73982491 missense probably benign 0.00
R4549:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4550:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4658:Snapc1 UTSW 12 73983868 missense possibly damaging 0.75
R6976:Snapc1 UTSW 12 73970200 missense probably damaging 1.00
R7432:Snapc1 UTSW 12 73968294 missense probably benign 0.01
R7488:Snapc1 UTSW 12 73982511 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAGGAATCTGGCGGTACAGTTACG -3'
(R):5'- AGGGTCTCTTTCAGCAACAAGAGC -3'

Sequencing Primer
(F):5'- GCTCTGTCCTCAGACCATTT -3'
(R):5'- taccccccaaccaaccc -3'
Posted On2013-08-06