Incidental Mutation 'R8117:Kctd19'
ID643772
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Namepotassium channel tetramerisation domain containing 19
Synonyms4922504H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8117 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105382807-105413502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105395437 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 109 (D109V)
Ref Sequence ENSEMBL: ENSMUSP00000131732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063071] [ENSMUST00000167294] [ENSMUST00000168888]
Predicted Effect silent
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect silent
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000168888
AA Change: D109V
SMART Domains Protein: ENSMUSP00000131732
Gene: ENSMUSG00000051648
AA Change: D109V

DomainStartEndE-ValueType
Pfam:BTB_2 15 95 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,448 T14A Het
2610008E11Rik T C 10: 79,094,455 N42D probably benign Het
Ankrd54 T A 15: 79,055,441 M183L Het
Apob G A 12: 8,006,435 G1639D probably damaging Het
B3gat2 A G 1: 23,844,980 T283A probably benign Het
Bmpr2 T G 1: 59,847,093 S296R probably damaging Het
Cand1 G A 10: 119,206,816 T1123I probably damaging Het
Cc2d2a T C 5: 43,712,439 F943S probably damaging Het
Ccdc40 T C 11: 119,253,385 I912T probably benign Het
Cdkn2d G A 9: 21,289,151 S108L probably benign Het
Cep295 G A 9: 15,334,364 T932I probably damaging Het
Cntn5 A G 9: 9,673,950 S716P probably benign Het
Col18a1 T C 10: 77,059,974 E903G probably benign Het
Ctrc T A 4: 141,838,661 I229F probably damaging Het
Cyb561d2 C T 9: 107,541,572 A18T probably benign Het
Dnajb4 T A 3: 152,193,452 K46* probably null Het
Dsc2 C T 18: 20,032,274 G881R possibly damaging Het
Dsg1c C T 18: 20,276,959 H495Y probably benign Het
Eif2b3 A G 4: 117,022,217 D18G probably damaging Het
Enam A T 5: 88,503,526 I965L probably benign Het
Fhod3 T A 18: 25,115,853 I1363K probably damaging Het
Fras1 A G 5: 96,707,386 Y1918C probably damaging Het
Fsip2 T A 2: 82,992,952 I6343N possibly damaging Het
Gm15922 G A 7: 3,737,076 T340I probably damaging Het
Gm996 A G 2: 25,579,234 F222L probably benign Het
Gpr45 G C 1: 43,033,315 V373L probably damaging Het
Hdac2 G T 10: 36,997,970 Q365H probably damaging Het
Hspa12b A G 2: 131,138,469 T103A possibly damaging Het
Ifrd1 A T 12: 40,212,351 S287T probably benign Het
Igkv6-15 G A 6: 70,406,638 P60S possibly damaging Het
Ippk C T 13: 49,446,342 P226S Het
Matn4 G A 2: 164,392,931 S540L probably damaging Het
Matn4 T C 2: 164,399,762 K248E probably benign Het
Muc16 G A 9: 18,508,910 Q97* probably null Het
Mup18 A G 4: 61,674,001 C9R unknown Het
Myh1 A G 11: 67,222,205 K1845R probably damaging Het
Mysm1 G A 4: 94,960,390 R469* probably null Het
Naip1 T C 13: 100,427,001 D552G possibly damaging Het
Nrcam A G 12: 44,571,588 D787G probably benign Het
Nrcam G A 12: 44,598,582 V1256I probably damaging Het
Obscn G T 11: 59,042,154 H4799N possibly damaging Het
Olfr1192-ps1 A G 2: 88,652,385 K78E probably damaging Het
Olfr1366 T C 13: 21,537,952 K3E probably benign Het
Olfr670 T C 7: 104,960,149 I194M probably damaging Het
Olfr837 A G 9: 19,137,057 I21M probably benign Het
Pcdhgb5 T C 18: 37,733,249 F699S probably damaging Het
Phtf2 T C 5: 20,802,040 E175G probably benign Het
Ppp2r5c A G 12: 110,551,085 H218R possibly damaging Het
Ptgs2 A G 1: 150,104,034 R297G probably damaging Het
Rapgef3 A T 15: 97,750,866 D619E probably benign Het
Ric1 G A 19: 29,574,791 V321I probably benign Het
Ripor1 T C 8: 105,617,473 V413A probably damaging Het
Rsf1 G T 7: 97,639,257 probably null Het
Sccpdh A G 1: 179,676,452 D122G probably damaging Het
Sec16a A T 2: 26,441,429 H191Q probably benign Het
Slco1a5 G T 6: 142,262,692 N124K probably damaging Het
Snrnp200 A G 2: 127,229,131 T1111A probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Tanc2 T A 11: 105,835,162 V384E probably damaging Het
Tbrg1 A G 9: 37,657,000 F49L possibly damaging Het
Tecta A G 9: 42,377,631 F546S probably damaging Het
Tmem132c A G 5: 127,360,112 R222G probably benign Het
Trub2 C T 2: 29,778,727 probably null Het
Tti1 G T 2: 158,007,498 P607Q probably damaging Het
Vmn1r62 T A 7: 5,675,727 F136I possibly damaging Het
Vmn2r111 T A 17: 22,571,488 H179L probably benign Het
Wdfy4 A T 14: 32,977,106 C2703* probably null Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Wipf3 A G 6: 54,483,831 K88R probably benign Het
Zfp641 C T 15: 98,288,975 G256R probably damaging Het
Zfp993 T A 4: 146,657,515 C99S probably benign Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R7923:Kctd19 UTSW 8 105385058 missense probably damaging 1.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCAATGAAGCGGAACTCG -3'
(R):5'- GCCAAGATATATCATTCAGTGTCC -3'

Sequencing Primer
(F):5'- GCTGCATTCGCACTCGATCAG -3'
(R):5'- AAGATTTTTCACACTTAGCTTCCCAG -3'
Posted On2020-08-13