Incidental Mutation 'R8024:Nmd3'
ID643773
Institutional Source Beutler Lab
Gene Symbol Nmd3
Ensembl Gene ENSMUSG00000027787
Gene NameNMD3 ribosome export adaptor
SynonymsC87860
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8024 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69721985-69756373 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 69729965 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029358] [ENSMUST00000135266] [ENSMUST00000143041] [ENSMUST00000143249]
Predicted Effect probably benign
Transcript: ENSMUST00000029358
SMART Domains Protein: ENSMUSP00000029358
Gene: ENSMUSG00000027787

DomainStartEndE-ValueType
Pfam:NMD3 17 246 6.6e-82 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135266
AA Change: V126E
SMART Domains Protein: ENSMUSP00000142290
Gene: ENSMUSG00000027787
AA Change: V126E

DomainStartEndE-ValueType
Pfam:NMD3 17 128 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143041
Predicted Effect probably benign
Transcript: ENSMUST00000143249
SMART Domains Protein: ENSMUSP00000115736
Gene: ENSMUSG00000027787

DomainStartEndE-ValueType
Pfam:NMD3 17 76 1.3e-19 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomal 40S and 60S subunits associate in the nucleolus and are exported to the cytoplasm. The protein encoded by this gene is involved in the passage of the 60S subunit through the nuclear pore complex and into the cytoplasm. Several transcript variants exist for this gene, but the full-length natures of only two have been described to date. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,594 N1257Y probably benign Het
2310057J18Rik A T 10: 28,982,595 Y133* probably null Het
2310057J18Rik A C 10: 28,986,217 S26A possibly damaging Het
4931409K22Rik A G 5: 24,550,636 M296T possibly damaging Het
9930012K11Rik G T 14: 70,156,667 P220T probably damaging Het
A430105I19Rik A G 2: 118,760,524 probably null Het
Adam1b A C 5: 121,500,923 S686R probably benign Het
Adam8 T C 7: 139,987,576 D418G probably damaging Het
Adcy8 A G 15: 64,920,246 L287P probably damaging Het
Adhfe1 T A 1: 9,563,855 M373K probably benign Het
Alpk2 T C 18: 65,305,035 S1096G probably benign Het
Ankmy1 A G 1: 92,884,994 V531A probably benign Het
Ano3 C T 2: 110,667,783 E738K probably damaging Het
Ano4 T A 10: 88,971,332 I796F probably damaging Het
Apeh T C 9: 108,092,591 E190G probably benign Het
Cadm3 A G 1: 173,338,055 L346P probably damaging Het
Clec2e G A 6: 129,094,425 H150Y possibly damaging Het
Cnga4 A T 7: 105,406,835 N318Y probably damaging Het
Cnr2 T A 4: 135,916,885 F91L probably damaging Het
Diaph3 T A 14: 86,656,399 E1147V probably damaging Het
Elmo2 T C 2: 165,291,855 T738A unknown Het
Exoc4 T A 6: 33,347,931 W387R probably damaging Het
Fam173b T C 15: 31,608,171 Y123H probably damaging Het
Focad T C 4: 88,397,000 V1379A unknown Het
Frmd4a T C 2: 4,603,702 S794P probably damaging Het
Ftl1-ps1 A G 13: 74,407,051 T150A probably benign Het
Gm43517 A T 12: 49,389,626 probably benign Het
Gm5773 C T 3: 93,773,168 A49V probably benign Het
Helz T A 11: 107,686,421 L1867Q unknown Het
Il22ra1 A G 4: 135,734,278 H118R probably benign Het
Inf2 C T 12: 112,608,902 P856S unknown Het
Ints5 T A 19: 8,896,140 L488I probably damaging Het
Kifc1 G A 17: 33,883,203 R479C probably damaging Het
Lrba T A 3: 86,295,401 C289* probably null Het
Mael A G 1: 166,226,627 L196S probably damaging Het
Med23 T A 10: 24,879,683 S229R possibly damaging Het
Mroh9 T C 1: 163,039,233 N645D probably benign Het
Myom3 G A 4: 135,801,748 V1132I probably benign Het
Naalad2 T G 9: 18,397,473 probably benign Het
Ndufa13 A T 8: 69,894,537 L71H probably damaging Het
Nepro A T 16: 44,731,415 H212L probably benign Het
Nox4 T A 7: 87,304,910 L141Q probably damaging Het
Olfr1254 T C 2: 89,789,046 E102G probably benign Het
Olfr283 T A 15: 98,378,997 M38L probably benign Het
Olfr473 T C 7: 107,934,438 V306A probably benign Het
Olfr482 T A 7: 108,095,289 T94S probably benign Het
Olfr811 T G 10: 129,801,943 E194A probably damaging Het
Pfpl A G 19: 12,430,206 D607G possibly damaging Het
Pkd1l2 A T 8: 117,076,182 F233L possibly damaging Het
Prl6a1 A G 13: 27,318,695 probably benign Het
Ptprz1 A T 6: 23,042,751 E2058V probably damaging Het
Rag1 A T 2: 101,642,507 N763K probably damaging Het
Rhbg A C 3: 88,248,453 D63E probably damaging Het
Rrm1 T A 7: 102,457,265 F330L probably benign Het
Scaf8 A T 17: 3,159,293 Q97L unknown Het
Sdr9c7 G A 10: 127,898,882 V80I probably benign Het
Slc18a1 A G 8: 69,075,147 V4A probably benign Het
Slco3a1 T A 7: 74,554,470 I41F probably benign Het
Slirp T C 12: 87,447,600 V45A probably damaging Het
Spata31 A T 13: 64,922,804 Q922L probably benign Het
Spg11 A G 2: 122,097,321 S661P possibly damaging Het
Stab2 G T 10: 86,846,052 T2495K probably benign Het
Supt16 A G 14: 52,170,875 I871T probably damaging Het
Sval2 A G 6: 41,860,364 Q9R probably damaging Het
Syngap1 A T 17: 26,941,452 M1L probably benign Het
Tfpi A T 2: 84,453,922 M62K possibly damaging Het
Tm4sf1 A T 3: 57,287,765 Y200* probably null Het
Tmc1 A T 19: 20,900,817 W105R probably damaging Het
Tmtc2 T C 10: 105,190,126 E827G probably benign Het
Tollip T C 7: 141,892,826 I33V probably benign Het
Unc80 T A 1: 66,606,644 V1493D possibly damaging Het
Vmn2r6 G A 3: 64,559,824 R85W probably benign Het
Vwa5a C A 9: 38,736,020 S565* probably null Het
Xbp1 T A 11: 5,521,910 V12D probably benign Het
Other mutations in Nmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Nmd3 APN 3 69745240 missense possibly damaging 0.63
IGL01014:Nmd3 APN 3 69726386 missense probably benign 0.00
IGL01289:Nmd3 APN 3 69724287 missense possibly damaging 0.85
IGL02566:Nmd3 APN 3 69739914 unclassified probably benign
IGL03259:Nmd3 APN 3 69745243 missense possibly damaging 0.49
IGL03299:Nmd3 APN 3 69730429 splice site probably null
IGL03382:Nmd3 APN 3 69735088 missense probably damaging 0.99
R0017:Nmd3 UTSW 3 69736092 splice site probably null
R0025:Nmd3 UTSW 3 69748321 missense probably damaging 1.00
R0350:Nmd3 UTSW 3 69743574 missense probably damaging 1.00
R1136:Nmd3 UTSW 3 69746716 splice site probably benign
R1635:Nmd3 UTSW 3 69739984 missense probably benign 0.03
R3081:Nmd3 UTSW 3 69724399 splice site probably benign
R3686:Nmd3 UTSW 3 69746762 missense probably damaging 1.00
R3758:Nmd3 UTSW 3 69724308 nonsense probably null
R4384:Nmd3 UTSW 3 69724398 splice site probably benign
R4774:Nmd3 UTSW 3 69745236 missense probably benign 0.11
R4778:Nmd3 UTSW 3 69731591 nonsense probably null
R4953:Nmd3 UTSW 3 69731637 missense possibly damaging 0.92
R5000:Nmd3 UTSW 3 69717402 unclassified probably benign
R5182:Nmd3 UTSW 3 69722468 critical splice donor site probably null
R6043:Nmd3 UTSW 3 69745247 missense probably benign
R6355:Nmd3 UTSW 3 69729347 missense probably benign 0.22
R6760:Nmd3 UTSW 3 69746837 critical splice donor site probably null
R7869:Nmd3 UTSW 3 69726417 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTCTTTGTGTGCCACATAGG -3'
(R):5'- TATACTACATTTGGGGAAGAGGGTG -3'

Sequencing Primer
(F):5'- CTCaactcagtaaatagtcaagag -3'
(R):5'- GGACCTTATGCATGCTGATCAAG -3'
Posted On2020-08-14