Incidental Mutation 'R8042:Ctc1'
ID643778
Institutional Source Beutler Lab
Gene Symbol Ctc1
Ensembl Gene ENSMUSG00000020898
Gene NameCTS telomere maintenance complex component 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8042 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69015911-69036473 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 69029843 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021278] [ENSMUST00000116359] [ENSMUST00000152979] [ENSMUST00000161455]
Predicted Effect probably benign
Transcript: ENSMUST00000021278
SMART Domains Protein: ENSMUSP00000021278
Gene: ENSMUSG00000020898

DomainStartEndE-ValueType
Pfam:CTC1 60 1195 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116359
SMART Domains Protein: ENSMUSP00000112063
Gene: ENSMUSG00000020898

DomainStartEndE-ValueType
Pfam:CTC1 61 1196 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152979
Predicted Effect probably benign
Transcript: ENSMUST00000161455
SMART Domains Protein: ENSMUSP00000124702
Gene: ENSMUSG00000020898

DomainStartEndE-ValueType
Pfam:CTC1 1 949 N/A PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit defective telomere replication that leads to stem cell exhaustion, bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,403,010 Y1582C possibly damaging Het
Acly A G 11: 100,514,325 I339T probably damaging Het
Adcy4 A G 14: 55,775,239 V541A probably benign Het
Arhgef3 T A 14: 27,362,809 V45D possibly damaging Het
Azi2 C A 9: 118,062,097 Q397K probably benign Het
Cacna1h G T 17: 25,392,471 S451* probably null Het
Cacna2d3 A T 14: 29,105,038 probably benign Het
Cep85l A G 10: 53,348,663 Y277H probably damaging Het
Cep97 C A 16: 55,911,602 V608L probably benign Het
Crb1 T A 1: 139,314,654 Y362F probably damaging Het
Diexf A G 1: 193,114,672 V1A Het
Dnah14 T C 1: 181,643,631 probably null Het
Dock4 T C 12: 40,745,760 F859L probably benign Het
Errfi1 T C 4: 150,866,457 F114S possibly damaging Het
Gbp9 T A 5: 105,094,242 I150F probably damaging Het
Loxhd1 C T 18: 77,431,192 T1898M probably damaging Het
Lrrc9 A T 12: 72,460,906 T394S probably benign Het
Ltbp2 T C 12: 84,791,899 E1115G probably damaging Het
Mast4 T C 13: 102,781,245 S552G probably damaging Het
Mgat4b T A 11: 50,232,376 Y263* probably null Het
Moxd2 T C 6: 40,885,367 I173V probably benign Het
Mrc2 T C 11: 105,348,355 V1312A probably damaging Het
Myh1 A T 11: 67,206,603 I465F probably damaging Het
Nadk G T 4: 155,577,067 D17Y probably benign Het
Nt5dc1 T C 10: 34,397,214 D196G probably benign Het
Obscn T C 11: 59,040,317 D5028G possibly damaging Het
Pabpc1 A G 15: 36,598,309 F447S probably benign Het
Pcsk6 T G 7: 65,927,935 N201K possibly damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ptpro A G 6: 137,416,883 T850A possibly damaging Het
Rnf213 A G 11: 119,441,654 D2564G Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sec24a T C 11: 51,704,317 T939A probably benign Het
Serpine1 A T 5: 137,067,001 L242H probably benign Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc6a6 A C 6: 91,741,245 I347L probably benign Het
Spns2 A T 11: 72,454,177 L495H possibly damaging Het
Stam2 A G 2: 52,706,397 probably null Het
Syt12 C A 19: 4,453,824 V260F probably damaging Het
Tdrd7 T A 4: 45,987,516 S50T possibly damaging Het
Tert T A 13: 73,627,145 V39E probably damaging Het
Tmem147 T A 7: 30,728,553 S75C probably damaging Het
Tnpo2 C T 8: 85,051,559 P564S probably damaging Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Zfp738 A G 13: 67,670,891 L327S probably damaging Het
Other mutations in Ctc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Ctc1 APN 11 69031149 missense probably damaging 1.00
IGL02135:Ctc1 APN 11 69021163 missense probably benign 0.25
IGL02164:Ctc1 APN 11 69026096 missense probably damaging 0.99
IGL02337:Ctc1 APN 11 69026131 missense probably damaging 1.00
IGL03149:Ctc1 APN 11 69031161 missense possibly damaging 0.55
PIT4810001:Ctc1 UTSW 11 69022526 missense probably benign 0.38
R0295:Ctc1 UTSW 11 69030588 missense possibly damaging 0.75
R0320:Ctc1 UTSW 11 69033537 missense probably damaging 1.00
R0496:Ctc1 UTSW 11 69035507 missense probably damaging 1.00
R1497:Ctc1 UTSW 11 69022561 missense probably benign 0.00
R1607:Ctc1 UTSW 11 69036150 missense possibly damaging 0.82
R1623:Ctc1 UTSW 11 69021142 missense probably damaging 0.99
R1856:Ctc1 UTSW 11 69034658 missense probably damaging 1.00
R1876:Ctc1 UTSW 11 69031564 missense probably benign 0.24
R1967:Ctc1 UTSW 11 69027862 critical splice acceptor site probably null
R2164:Ctc1 UTSW 11 69035615 missense possibly damaging 0.92
R2348:Ctc1 UTSW 11 69026191 missense probably benign 0.43
R2428:Ctc1 UTSW 11 69027701 missense possibly damaging 0.51
R3964:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3965:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3966:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R4398:Ctc1 UTSW 11 69022871 missense probably damaging 1.00
R4508:Ctc1 UTSW 11 69016117 splice site probably null
R4605:Ctc1 UTSW 11 69029726 missense possibly damaging 0.86
R4976:Ctc1 UTSW 11 69027326 missense probably damaging 1.00
R4979:Ctc1 UTSW 11 69033502 missense probably damaging 1.00
R5268:Ctc1 UTSW 11 69029810 missense possibly damaging 0.67
R6023:Ctc1 UTSW 11 69022607 missense probably benign 0.00
R6053:Ctc1 UTSW 11 69027901 missense probably benign 0.01
R7204:Ctc1 UTSW 11 69029741 missense probably damaging 1.00
R7252:Ctc1 UTSW 11 69026174 missense probably damaging 1.00
R7357:Ctc1 UTSW 11 69034742 missense probably benign 0.17
R7654:Ctc1 UTSW 11 69026215 missense probably damaging 1.00
R7724:Ctc1 UTSW 11 69026344 missense probably benign 0.00
R7890:Ctc1 UTSW 11 69026529 missense probably damaging 1.00
R7979:Ctc1 UTSW 11 69027383 nonsense probably null
R8167:Ctc1 UTSW 11 69027758 missense probably damaging 1.00
R8179:Ctc1 UTSW 11 69024224 missense probably benign 0.18
R8353:Ctc1 UTSW 11 69022449 missense probably benign 0.03
R8453:Ctc1 UTSW 11 69022449 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGCTTGACCTTTATTTCCTACAGG -3'
(R):5'- AGTCGAATAAGACCAGTGTTCTTC -3'

Sequencing Primer
(F):5'- CCTACAGGTTTTACTTGGGGTCC -3'
(R):5'- AAGGTAAATGTTTAGGAGCTATGTG -3'
Posted On2020-08-14