Incidental Mutation 'R8140:Amotl1'
ID643786
Institutional Source Beutler Lab
Gene Symbol Amotl1
Ensembl Gene ENSMUSG00000013076
Gene Nameangiomotin-like 1
SynonymsJEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R8140 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location14541966-14645056 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 14572715 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000223132]
Predicted Effect probably null
Transcript: ENSMUST00000013220
SMART Domains Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076

DomainStartEndE-ValueType
low complexity region 203 224 N/A INTRINSIC
low complexity region 418 441 N/A INTRINSIC
coiled coil region 449 472 N/A INTRINSIC
Blast:PAC 491 532 1e-10 BLAST
low complexity region 562 575 N/A INTRINSIC
Pfam:Angiomotin_C 616 822 4.4e-96 PFAM
low complexity region 853 878 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223132
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Amotl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Amotl1 APN 9 14571715 splice site probably benign
IGL02750:Amotl1 APN 9 14548791 missense probably benign 0.34
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0178:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0179:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0853:Amotl1 UTSW 9 14592778 missense probably damaging 0.99
R0941:Amotl1 UTSW 9 14596558 missense possibly damaging 0.90
R1447:Amotl1 UTSW 9 14555742 missense probably benign
R1689:Amotl1 UTSW 9 14593222 missense probably damaging 0.99
R1692:Amotl1 UTSW 9 14551722 missense possibly damaging 0.94
R1858:Amotl1 UTSW 9 14575401 missense probably benign 0.34
R2158:Amotl1 UTSW 9 14575169 missense probably benign 0.00
R2184:Amotl1 UTSW 9 14575390 missense probably benign 0.00
R3040:Amotl1 UTSW 9 14572773 missense probably benign 0.42
R4226:Amotl1 UTSW 9 14593678 missense probably benign 0.00
R4776:Amotl1 UTSW 9 14593373 nonsense probably null
R4854:Amotl1 UTSW 9 14593451 nonsense probably null
R5283:Amotl1 UTSW 9 14558484 missense probably damaging 1.00
R5478:Amotl1 UTSW 9 14592752 critical splice donor site probably null
R5562:Amotl1 UTSW 9 14575297 missense possibly damaging 0.56
R5970:Amotl1 UTSW 9 14596528 missense probably damaging 1.00
R6265:Amotl1 UTSW 9 14571655 missense possibly damaging 0.93
R6974:Amotl1 UTSW 9 14644920 nonsense probably null
R7016:Amotl1 UTSW 9 14593699 missense probably damaging 0.99
R7058:Amotl1 UTSW 9 14575236 missense possibly damaging 0.94
R7317:Amotl1 UTSW 9 14575219 missense probably benign 0.02
R7730:Amotl1 UTSW 9 14555763 missense possibly damaging 0.53
R7994:Amotl1 UTSW 9 14593361 missense probably damaging 0.98
R7996:Amotl1 UTSW 9 14593705 missense possibly damaging 0.94
R8077:Amotl1 UTSW 9 14550502 missense probably damaging 1.00
R8116:Amotl1 UTSW 9 14555572 critical splice donor site probably null
R8362:Amotl1 UTSW 9 14644922 missense probably benign 0.26
R8364:Amotl1 UTSW 9 14644922 missense probably benign 0.26
R8526:Amotl1 UTSW 9 14562196 missense probably damaging 1.00
R8855:Amotl1 UTSW 9 14555573 critical splice donor site probably null
R8904:Amotl1 UTSW 9 14558565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGAGATCGATTTTCAGAGC -3'
(R):5'- GACAGTCAGCATCACAGAGG -3'

Sequencing Primer
(F):5'- TTCATAAGGCAGCTAGTCTGGAGC -3'
(R):5'- GAGGCCCTGTCACAAATACCG -3'
Posted On2020-08-14