Mutagenetix > Incidental Mutation

Incidental Mutation 'R8140:Amotl1'

643786

Institutional Source

Beutler Lab

Gene Symbol

Amotl1

Ensembl Gene

ENSMUSG00000013076

Gene Name

angiomotin-like 1

Synonyms

JEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14541966-14645056 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 14572715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000223132]

AlphaFold

Q9D4H4

Predicted Effect

probably null
Transcript: ENSMUST00000013220

SMART Domains

Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076

Domain	Start	End	E-Value	Type
low complexity region	203	224	N/A	INTRINSIC
low complexity region	418	441	N/A	INTRINSIC
coiled coil region	449	472	N/A	INTRINSIC
Blast:PAC	491	532	1e-10	BLAST
low complexity region	562	575	N/A	INTRINSIC
Pfam:Angiomotin_C	616	822	4.4e-96	PFAM
low complexity region	853	878	N/A	INTRINSIC
low complexity region	881	895	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000223132

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Amotl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02157:Amotl1	APN	9	14571715	splice site	probably benign
IGL02750:Amotl1	APN	9	14548791	missense	probably benign	0.34
R0071:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0071:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0094:Amotl1	UTSW	9	14575387	missense	probably benign	0.12
R0094:Amotl1	UTSW	9	14575387	missense	probably benign	0.12
R0178:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0179:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0853:Amotl1	UTSW	9	14592778	missense	probably damaging	0.99
R0941:Amotl1	UTSW	9	14596558	missense	possibly damaging	0.90
R1447:Amotl1	UTSW	9	14555742	missense	probably benign
R1689:Amotl1	UTSW	9	14593222	missense	probably damaging	0.99
R1692:Amotl1	UTSW	9	14551722	missense	possibly damaging	0.94
R1858:Amotl1	UTSW	9	14575401	missense	probably benign	0.34
R2158:Amotl1	UTSW	9	14575169	missense	probably benign	0.00
R2184:Amotl1	UTSW	9	14575390	missense	probably benign	0.00
R3040:Amotl1	UTSW	9	14572773	missense	probably benign	0.42
R4226:Amotl1	UTSW	9	14593678	missense	probably benign	0.00
R4776:Amotl1	UTSW	9	14593373	nonsense	probably null
R4854:Amotl1	UTSW	9	14593451	nonsense	probably null
R5283:Amotl1	UTSW	9	14558484	missense	probably damaging	1.00
R5478:Amotl1	UTSW	9	14592752	critical splice donor site	probably null
R5562:Amotl1	UTSW	9	14575297	missense	possibly damaging	0.56
R5970:Amotl1	UTSW	9	14596528	missense	probably damaging	1.00
R6265:Amotl1	UTSW	9	14571655	missense	possibly damaging	0.93
R6974:Amotl1	UTSW	9	14644920	nonsense	probably null
R7016:Amotl1	UTSW	9	14593699	missense	probably damaging	0.99
R7058:Amotl1	UTSW	9	14575236	missense	possibly damaging	0.94
R7317:Amotl1	UTSW	9	14575219	missense	probably benign	0.02
R7730:Amotl1	UTSW	9	14555763	missense	possibly damaging	0.53
R7994:Amotl1	UTSW	9	14593361	missense	probably damaging	0.98
R7996:Amotl1	UTSW	9	14593705	missense	possibly damaging	0.94
R8077:Amotl1	UTSW	9	14550502	missense	probably damaging	1.00
R8116:Amotl1	UTSW	9	14555572	critical splice donor site	probably null
R8362:Amotl1	UTSW	9	14644922	missense	probably benign	0.26
R8364:Amotl1	UTSW	9	14644922	missense	probably benign	0.26
R8526:Amotl1	UTSW	9	14562196	missense	probably damaging	1.00
R8855:Amotl1	UTSW	9	14555573	critical splice donor site	probably null
R8904:Amotl1	UTSW	9	14558565	missense	probably damaging	1.00
R9179:Amotl1	UTSW	9	14550491	missense	possibly damaging	0.89
R9228:Amotl1	UTSW	9	14593024	missense	possibly damaging	0.69
R9361:Amotl1	UTSW	9	14593381	missense	probably benign	0.03
R9513:Amotl1	UTSW	9	14614767	missense	probably benign
R9563:Amotl1	UTSW	9	14562217	missense	possibly damaging	0.95
R9564:Amotl1	UTSW	9	14562217	missense	possibly damaging	0.95
R9620:Amotl1	UTSW	9	14548673	missense	probably damaging	1.00
R9654:Amotl1	UTSW	9	14551685	missense	probably benign	0.19
R9750:Amotl1	UTSW	9	14592806	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCCTGAGATCGATTTTCAGAGC -3'
(R):5'- GACAGTCAGCATCACAGAGG -3'

Sequencing Primer
(F):5'- TTCATAAGGCAGCTAGTCTGGAGC -3'
(R):5'- GAGGCCCTGTCACAAATACCG -3'

Posted On

2020-08-14