Mutagenetix > Incidental Mutation

Incidental Mutation 'R8140:Erbin'

643787

Institutional Source

Beutler Lab

Gene Symbol

Erbin

Ensembl Gene

ENSMUSG00000021709

Gene Name

Erbb2 interacting protein

Synonyms

1700028E05Rik, Erbb2ip, Erbin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8140 (G1)

Quality Score

147.008

Status

Validated

Chromosome

Chromosomal Location

103818787-103920514 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 103920294 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]

AlphaFold

Q80TH2

Predicted Effect

probably benign
Transcript: ENSMUST00000022222

SMART Domains

Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1294	1374	3.6e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000091269

SMART Domains

Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1320	1400	3.6e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169083

SMART Domains

Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1329	1409	3.6e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000188997

SMART Domains

Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1212	1292	3.6e-16	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000191275

SMART Domains

Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1368	1448	3.6e-16	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Erbin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Erbin	APN	13	103834012	missense	probably damaging	1.00
IGL01404:Erbin	APN	13	103839464	missense	probably damaging	1.00
IGL01455:Erbin	APN	13	103859387	missense	probably damaging	1.00
IGL01871:Erbin	APN	13	103834766	missense	probably damaging	0.98
IGL01930:Erbin	APN	13	103841172	missense	probably damaging	1.00
IGL02112:Erbin	APN	13	103862336	missense	probably benign	0.12
IGL02736:Erbin	APN	13	103839395	missense	probably damaging	1.00
IGL03149:Erbin	APN	13	103841163	missense	possibly damaging	0.82
IGL03169:Erbin	APN	13	103841232	missense	possibly damaging	0.93
regard	UTSW	13	103844921	nonsense	probably null
wishes	UTSW	13	103843451	splice site	probably benign
IGL02802:Erbin	UTSW	13	103868130	missense	probably damaging	1.00
PIT1430001:Erbin	UTSW	13	103859509	missense	probably damaging	1.00
R0329:Erbin	UTSW	13	103868865	missense	probably damaging	1.00
R0330:Erbin	UTSW	13	103868865	missense	probably damaging	1.00
R0492:Erbin	UTSW	13	103834358	missense	probably damaging	0.98
R0508:Erbin	UTSW	13	103834027	missense	probably damaging	1.00
R0589:Erbin	UTSW	13	103886287	missense	probably damaging	1.00
R1103:Erbin	UTSW	13	103886202	missense	probably benign	0.00
R1139:Erbin	UTSW	13	103884253	missense	probably damaging	1.00
R1316:Erbin	UTSW	13	103841234	missense	possibly damaging	0.94
R1675:Erbin	UTSW	13	103841178	missense	probably damaging	1.00
R1698:Erbin	UTSW	13	103833731	missense	possibly damaging	0.91
R1727:Erbin	UTSW	13	103827968	missense	probably benign	0.01
R1745:Erbin	UTSW	13	103839449	missense	probably damaging	1.00
R1746:Erbin	UTSW	13	103850831	missense	probably damaging	1.00
R1764:Erbin	UTSW	13	103843451	splice site	probably benign
R1828:Erbin	UTSW	13	103860069	critical splice donor site	probably null
R1840:Erbin	UTSW	13	103834947	missense	probably benign	0.01
R1987:Erbin	UTSW	13	103886203	missense	probably benign	0.36
R1992:Erbin	UTSW	13	103833713	missense	probably benign	0.33
R2013:Erbin	UTSW	13	103857533	missense	probably damaging	1.00
R2025:Erbin	UTSW	13	103830195	missense	probably benign	0.01
R2056:Erbin	UTSW	13	103830316	missense	probably benign	0.27
R2171:Erbin	UTSW	13	103834958	missense	probably benign	0.00
R2366:Erbin	UTSW	13	103844909	missense	probably damaging	1.00
R2897:Erbin	UTSW	13	103886197	missense	probably damaging	1.00
R3912:Erbin	UTSW	13	103862287	missense	probably benign	0.35
R3912:Erbin	UTSW	13	103886338	splice site	probably benign
R4073:Erbin	UTSW	13	103860111	missense	probably damaging	1.00
R4458:Erbin	UTSW	13	103833557	missense	probably damaging	1.00
R4465:Erbin	UTSW	13	103844885	missense	probably benign	0.05
R4525:Erbin	UTSW	13	103857092	missense	probably benign
R4780:Erbin	UTSW	13	103884206	missense	probably damaging	1.00
R4877:Erbin	UTSW	13	103850838	missense	probably damaging	0.99
R4879:Erbin	UTSW	13	103834774	missense	probably benign	0.05
R5396:Erbin	UTSW	13	103857409	critical splice donor site	probably null
R5898:Erbin	UTSW	13	103839305	critical splice donor site	probably null
R5955:Erbin	UTSW	13	103830192	missense	probably benign	0.40
R6073:Erbin	UTSW	13	103844921	nonsense	probably null
R6107:Erbin	UTSW	13	103833892	missense	probably benign	0.06
R6257:Erbin	UTSW	13	103862288	missense	probably benign	0.35
R6294:Erbin	UTSW	13	103857056	missense	probably benign	0.36
R6358:Erbin	UTSW	13	103845565	missense	probably damaging	1.00
R6476:Erbin	UTSW	13	103841247	missense	probably damaging	1.00
R6485:Erbin	UTSW	13	103868113	missense	probably damaging	1.00
R6631:Erbin	UTSW	13	103824892	missense	probably benign	0.02
R6735:Erbin	UTSW	13	103884210	missense	probably damaging	1.00
R6736:Erbin	UTSW	13	103834766	missense	possibly damaging	0.72
R6749:Erbin	UTSW	13	103834377	missense	probably damaging	1.00
R7290:Erbin	UTSW	13	103862326	missense	probably damaging	1.00
R7767:Erbin	UTSW	13	103859399	missense	probably damaging	1.00
R8052:Erbin	UTSW	13	103834356	nonsense	probably null
R8104:Erbin	UTSW	13	103834977	missense	possibly damaging	0.89
R8303:Erbin	UTSW	13	103830186	critical splice donor site	probably null
R8392:Erbin	UTSW	13	103834062	missense	probably damaging	1.00
R8811:Erbin	UTSW	13	103886316	missense	probably damaging	1.00
R8924:Erbin	UTSW	13	103839458	nonsense	probably null
R9267:Erbin	UTSW	13	103850784	missense	probably damaging	1.00
R9794:Erbin	UTSW	13	103834851	missense	probably benign
R9799:Erbin	UTSW	13	103834876	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATCAGTTCTACTATTCGGCGGC -3'
(R):5'- TTTTCCTTCGGCGGAGAAGC -3'

Sequencing Primer
(F):5'- CTATTCGGCGGCTAAAATGC -3'
(R):5'- CGGAGAAGCGAGCCGGG -3'

Posted On

2020-08-14