Incidental Mutation 'R8165:Dnase1l3'
ID643792
Institutional Source Beutler Lab
Gene Symbol Dnase1l3
Ensembl Gene ENSMUSG00000025279
Gene Namedeoxyribonuclease 1-like 3
SynonymsDNasegamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8165 (G1)
Quality Score57.0073
Status Validated
Chromosome14
Chromosomal Location7964533-7994573 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 7994299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026315]
Predicted Effect probably benign
Transcript: ENSMUST00000026315
SMART Domains Protein: ENSMUSP00000026315
Gene: ENSMUSG00000025279

DomainStartEndE-ValueType
DNaseIc 9 287 1.24e-210 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the deoxyribonuclease I family. The encoded protein hydrolyzes DNA, is not inhibited by actin, and mediates the breakdown of DNA during apoptosis. Mutations in this gene are a cause of systemic lupus erythematosus-16. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired necrosis-associated internucleosomal DNA fragmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lin54 A G 5: 100,454,499 V393A probably benign Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Dnase1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Dnase1l3 APN 14 7984146 missense probably benign 0.28
R0668:Dnase1l3 UTSW 14 7968086 critical splice donor site probably null
R1282:Dnase1l3 UTSW 14 7983117 missense probably benign 0.16
R1460:Dnase1l3 UTSW 14 7974050 missense probably benign 0.10
R1768:Dnase1l3 UTSW 14 7974104 missense probably damaging 1.00
R2418:Dnase1l3 UTSW 14 7968089 missense possibly damaging 0.89
R5175:Dnase1l3 UTSW 14 7987386 nonsense probably null
R5271:Dnase1l3 UTSW 14 7993843 missense probably damaging 1.00
R5508:Dnase1l3 UTSW 14 7968146 missense probably damaging 1.00
R5561:Dnase1l3 UTSW 14 7967847 missense probably damaging 1.00
R6374:Dnase1l3 UTSW 14 7974115 missense probably damaging 1.00
R7734:Dnase1l3 UTSW 14 7977144 missense probably benign 0.04
R8421:Dnase1l3 UTSW 14 7968122 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACGCGTTTCAATCCCCAAGG -3'
(R):5'- CACCTTCCTCAGATGCCAAG -3'

Sequencing Primer
(F):5'- TCCCCAAGGAAATGAAGGTAATG -3'
(R):5'- TCCTCAGATGCCAAGGTATCC -3'
Posted On2020-08-19