Incidental Mutation 'R8110:Usp50'
ID 643806
Institutional Source Beutler Lab
Gene Symbol Usp50
Ensembl Gene ENSMUSG00000027364
Gene Name ubiquitin specific peptidase 50
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8110 (G1)
Quality Score 107.008
Status Validated
Chromosome 2
Chromosomal Location 126709096-126783470 bp(-) (GRCm38)
Type of Mutation splice site (58 bp from exon)
DNA Base Change (assembly) T to A at 126780330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028842] [ENSMUST00000130356] [ENSMUST00000136319]
AlphaFold Q6P8X6
Predicted Effect probably null
Transcript: ENSMUST00000028842
SMART Domains Protein: ENSMUSP00000028842
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 44 360 9.2e-67 PFAM
Pfam:UCH_1 45 342 2.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130356
SMART Domains Protein: ENSMUSP00000116873
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 8 183 1.5e-20 PFAM
Pfam:UCH_1 22 194 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Usp50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Usp50 APN 2 126709414 missense probably damaging 0.98
IGL01565:Usp50 APN 2 126777968 nonsense probably null
IGL01976:Usp50 APN 2 126709466 missense probably benign 0.10
IGL02192:Usp50 APN 2 126778038 missense possibly damaging 0.94
IGL02272:Usp50 APN 2 126769944 missense probably damaging 0.98
IGL02892:Usp50 APN 2 126769902 missense probably damaging 1.00
PIT4453001:Usp50 UTSW 2 126783316 start gained probably benign
R0034:Usp50 UTSW 2 126777975 missense possibly damaging 0.89
R0382:Usp50 UTSW 2 126777928 missense probably damaging 1.00
R0433:Usp50 UTSW 2 126761544 missense probably damaging 0.98
R1146:Usp50 UTSW 2 126709472 missense probably benign 0.02
R1457:Usp50 UTSW 2 126761634 missense probably benign 0.41
R1475:Usp50 UTSW 2 126769867 splice site probably null
R1758:Usp50 UTSW 2 126775862 missense probably damaging 1.00
R1889:Usp50 UTSW 2 126777898 critical splice donor site probably null
R1940:Usp50 UTSW 2 126778023 missense probably benign 0.03
R1959:Usp50 UTSW 2 126777961 missense possibly damaging 0.91
R2698:Usp50 UTSW 2 126778029 missense probably damaging 0.97
R4648:Usp50 UTSW 2 126778033 missense probably damaging 0.98
R4809:Usp50 UTSW 2 126777853 intron probably benign
R6247:Usp50 UTSW 2 126775793 missense probably benign 0.33
R7030:Usp50 UTSW 2 126780475 missense possibly damaging 0.78
R7186:Usp50 UTSW 2 126783298 start gained probably benign
R7522:Usp50 UTSW 2 126783226 missense probably damaging 1.00
R8856:Usp50 UTSW 2 126780557 missense probably damaging 0.99
X0064:Usp50 UTSW 2 126761646 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGGCAAATATTCCCTGCTG -3'
(R):5'- TGCAGACTATGACTCCCTGC -3'

Sequencing Primer
(F):5'- GGCAAATATTCCCTGCTGATTTAATG -3'
(R):5'- TCCCTGCCGGAGTCTAAGAC -3'
Posted On 2020-08-19