Incidental Mutation 'R8136:Sppl2a'
ID643824
Institutional Source Beutler Lab
Gene Symbol Sppl2a
Ensembl Gene ENSMUSG00000027366
Gene Namesignal peptide peptidase like 2A
SynonymsC130089K23Rik, 2010106G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8136 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126890391-126933235 bp(-) (GRCm38)
Type of Mutationsplice site (19 bp from exon)
DNA Base Change (assembly) T to C at 126913281 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028844]
Predicted Effect probably null
Transcript: ENSMUST00000028844
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143700
SMART Domains Protein: ENSMUSP00000119064
Gene: ENSMUSG00000027366

DomainStartEndE-ValueType
PSN 3 233 1.27e-60 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases, which are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions, as well as a member of the signal peptide peptidase-like protease (SPPL) family. This protein is expressed in all major adult human tissues and localizes to late endosomal compartments and lysosomal membranes. A pseudogene of this gene also lies on chromosome 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Sppl2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.04
IGL01471:Sppl2a APN 2 126917867 nonsense probably null
IGL01572:Sppl2a APN 2 126920312 splice site probably null
IGL01712:Sppl2a APN 2 126904903 splice site probably benign
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.68
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.07
abra UTSW 2 126923594 missense probably benign 0.00
abra2 UTSW 2 126920313 splice site probably null
isaac UTSW 2 126913575 missense probably damaging 1.00
jacob UTSW 2 126913281 splice site probably null
PIT4431001:Sppl2a UTSW 2 126923476 missense probably damaging 1.00
R0023:Sppl2a UTSW 2 126913293 splice site probably null
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 unclassified probably benign
R0799:Sppl2a UTSW 2 126920307 splice site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice site probably benign
R1669:Sppl2a UTSW 2 126917794 splice site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2215:Sppl2a UTSW 2 126927834 missense probably benign 0.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 splice site probably null
R5398:Sppl2a UTSW 2 126919718 missense probably benign 0.00
R6382:Sppl2a UTSW 2 126917029 splice site probably null
R6888:Sppl2a UTSW 2 126904992 missense probably damaging 0.99
R6892:Sppl2a UTSW 2 126913575 missense probably damaging 1.00
R7021:Sppl2a UTSW 2 126927743 splice site probably null
R7750:Sppl2a UTSW 2 126919705 missense probably damaging 1.00
R8129:Sppl2a UTSW 2 126923470 missense probably damaging 1.00
R8772:Sppl2a UTSW 2 126926311 missense probably benign 0.16
RF016:Sppl2a UTSW 2 126927774 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTATATCCGACACATGGAGGGTG -3'
(R):5'- CTCCTGTAACTCATTGGTCATGG -3'

Sequencing Primer
(F):5'- GGTGAACGGTATGACTATACTTCCC -3'
(R):5'- GGTGCATGCTAAGGTGTTACCAAAC -3'
Posted On2020-08-26