Incidental Mutation 'R8136:Btnl1'
ID 643825
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms Btnl3, LOC240074, LOC240074, NG10
MMRRC Submission
Accession Numbers

Genbank: NM_001111094; MGI: 1932027

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 92.0077
Status Validated
Chromosome 17
Chromosomal Location 34377132-34385776 bp(+) (GRCm38)
Type of Mutation splice site (193 bp from exon)
DNA Base Change (assembly) T to A at 34380040 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect probably null
Transcript: ENSMUST00000080254
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Rab3c A T 13: 110,181,020 Y110* probably null Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34381117 missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34385685 missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34379535 missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34382265 missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34385512 missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34381056 missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0021:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R0371:Btnl1 UTSW 17 34381057 missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34381208 nonsense probably null
R1982:Btnl1 UTSW 17 34379751 missense possibly damaging 0.81
R2109:Btnl1 UTSW 17 34379604 missense probably damaging 1.00
R2134:Btnl1 UTSW 17 34385634 missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34381038 missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34381159 missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34382462 missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34379725 missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34379751 missense probably null 0.99
R5579:Btnl1 UTSW 17 34381552 critical splice donor site probably null
R5811:Btnl1 UTSW 17 34385529 missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34379494 missense probably benign 0.01
R6602:Btnl1 UTSW 17 34385748 missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34385331 missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34385673 missense possibly damaging 0.86
R8840:Btnl1 UTSW 17 34385603 missense probably benign 0.17
R9120:Btnl1 UTSW 17 34379707 missense possibly damaging 0.85
RF041:Btnl1 UTSW 17 34381368 missense probably benign 0.04
X0026:Btnl1 UTSW 17 34377932 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCACAATGTAACTGCCACC -3'
(R):5'- CCACATTAAAGCCTGGGTGTG -3'

Sequencing Primer
(F):5'- TGTAACTGCCACCATCAGAGTTTAAC -3'
(R):5'- TCCCATCTCAAAAGACATGGTGG -3'
Posted On 2020-08-26