Incidental Mutation 'R8076:Dock5'
ID643830
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Namededicator of cytokinesis 5
Synonymslr2, 1110060D06Rik, rlc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R8076 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location67752135-67933442 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 67802977 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
Predicted Effect probably null
Transcript: ENSMUST00000039135
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A C 10: 82,296,686 Y163* probably null Het
5330417C22Rik G T 3: 108,492,082 T64K probably benign Het
Adam9 T A 8: 24,962,922 R790* probably null Het
Adamts13 C A 2: 26,990,612 P736T probably benign Het
Aldh3b2 T A 19: 3,978,859 F176L possibly damaging Het
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arid4b A T 13: 14,186,950 E753D probably benign Het
Cd160 T A 3: 96,802,346 T158S probably benign Het
Cd209g T A 8: 4,135,195 M1K probably null Het
Chrm4 A G 2: 91,927,859 Y204C probably damaging Het
Cyld T A 8: 88,729,718 N465K probably benign Het
Dchs1 A T 7: 105,755,921 H2471Q possibly damaging Het
Dchs1 A G 7: 105,761,982 V1612A probably damaging Het
Ddx24 A G 12: 103,416,218 V702A probably damaging Het
Dnah8 A G 17: 30,784,153 T3609A possibly damaging Het
Dpy19l2 C T 9: 24,680,692 R205H probably damaging Het
Eif3a A T 19: 60,773,925 D473E probably damaging Het
Elobl T C 11: 88,964,970 E89G possibly damaging Het
Fam186a A T 15: 99,943,470 I1631N possibly damaging Het
Fbn2 C T 18: 58,026,424 W2411* probably null Het
Fbxl17 A G 17: 63,060,365 I671T probably damaging Het
Glul C T 1: 153,907,122 T193I possibly damaging Het
Grm7 A G 6: 111,566,039 Y907C probably damaging Het
Hist4h4 A G 6: 136,804,126 M85T probably benign Het
Hr A G 14: 70,557,941 T309A probably benign Het
Ighg3 A G 12: 113,360,538 S110P probably benign Het
Llgl2 A G 11: 115,846,929 E180G possibly damaging Het
Mat2b A T 11: 40,685,265 L112Q probably damaging Het
Mcoln2 T C 3: 146,190,414 M497T probably damaging Het
Mmp24 C A 2: 155,807,561 Y299* probably null Het
Mtor T C 4: 148,525,803 probably null Het
Olfr1123 A T 2: 87,418,545 I164L probably benign Het
Olig2 C A 16: 91,226,411 D4E probably damaging Het
Pard3 T C 8: 127,415,596 S878P probably damaging Het
Pcgf5 C T 19: 36,440,083 P137L probably damaging Het
Pck1 A G 2: 173,155,278 N238D probably damaging Het
Pstpip1 T C 9: 56,127,780 S346P probably benign Het
Qsox2 G A 2: 26,224,885 H40Y possibly damaging Het
Rbpj T C 5: 53,642,137 I129T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Saal1 G A 7: 46,710,607 P9L probably benign Het
Sema3c A G 5: 17,727,364 I622V probably benign Het
Sigirr C T 7: 141,091,872 V333M probably benign Het
Sort1 T C 3: 108,338,867 S387P probably damaging Het
Spta1 T A 1: 174,187,231 S426T probably benign Het
Stag3 G A 5: 138,283,142 S124N probably damaging Het
Stard10 A G 7: 101,343,969 Y244C probably damaging Het
Tcea3 T A 4: 136,268,129 I261N probably damaging Het
Tdrd1 A G 19: 56,843,835 K395E probably damaging Het
Tenm2 T A 11: 36,027,221 D1905V probably benign Het
Trim12c T C 7: 104,340,830 Y480C unknown Het
Trip11 A G 12: 101,883,482 V1441A probably damaging Het
Ttc21a G A 9: 119,966,326 R1107Q probably benign Het
Wdr41 A G 13: 95,017,330 I296V probably benign Het
Zdbf2 T A 1: 63,306,101 V1213E possibly damaging Het
Zfp37 T C 4: 62,191,316 N545D possibly damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67759161 missense probably benign 0.00
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATTCGGGCCCTCACACTAAG -3'
(R):5'- CTGCAGAGTGTTTAGAGCAAGTG -3'

Sequencing Primer
(F):5'- GGCCCTCACACTAAGCCATTTG -3'
(R):5'- CAGGTAGCCATGTGTGAGC -3'
Posted On2020-08-27