Mutagenetix > Incidental Mutations

Incidental Mutation 'R8174:Ddx60'

643834

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R8174 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 62017250 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

Predicted Effect

probably null
Transcript: ENSMUST00000070631

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000093485

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	T	G	1: 85,099,540	S102R	probably damaging	Het
Akap13	A	G	7: 75,728,869	N2090S	possibly damaging	Het
Asxl3	T	C	18: 22,517,743	S930P	probably benign	Het
Cachd1	T	A	4: 100,966,269	I506N	probably damaging	Het
Calm1	G	T	12: 100,205,708	V140L	probably benign	Het
Cdsn	A	T	17: 35,555,632	K353*	probably null	Het
Cldn11	T	C	3: 31,154,061	V125A	probably benign	Het
Dlg2	A	G	7: 91,940,040	I216V	probably benign	Het
Dnah5	A	G	15: 28,311,133		probably null	Het
Dnajc28	G	A	16: 91,616,907	R150*	probably null	Het
Erap1	A	T	13: 74,646,564	Y114F	probably benign	Het
Fam179b	G	T	12: 64,982,691	D963Y	possibly damaging	Het
Gm14443	G	A	2: 175,169,675	P326L	probably damaging	Het
Gm2042	T	A	12: 87,960,158	L415Q	probably damaging	Het
Gm8797	T	C	3: 5,751,034	I44T	probably benign	Het
Matn2	C	A	15: 34,422,409	F547L	probably benign	Het
Mpc2	T	A	1: 165,480,889		probably null	Het
Olfr1445	A	G	19: 12,883,904	T8A	probably benign	Het
Olfr77	A	C	9: 19,920,724	T172P	probably damaging	Het
Pcnx4	T	A	12: 72,556,913	L536Q	probably damaging	Het
Phlpp2	G	A	8: 109,868,689	R24H	unknown	Het
Pkmyt1	A	T	17: 23,733,839	D123V	probably damaging	Het
Polg	A	T	7: 79,456,718	M668K	probably benign	Het
Ppp1r12a	G	T	10: 108,271,737	A974S	probably benign	Het
Ppp2r3a	T	C	9: 101,213,302		probably benign	Het
Rabl3	T	C	16: 37,556,863	Y61H	probably damaging	Het
Rap2a	T	A	14: 120,478,857	I44N	probably damaging	Het
Rev3l	T	C	10: 39,859,115	V2779A	probably damaging	Het
Rnf43	G	T	11: 87,731,231	R259L	probably benign	Het
Rspry1	T	A	8: 94,649,822	L448Q	probably damaging	Het
Slc43a2	T	G	11: 75,543,367		probably null	Het
Slc6a5	A	G	7: 49,948,309	I640M	probably benign	Het
Srrm2	C	T	17: 23,815,323	P314S	unknown	Het
Strn4	C	T	7: 16,828,808	R291C	probably damaging	Het
Syt4	T	A	18: 31,444,177	R41S	probably benign	Het
Tfb1m	T	C	17: 3,519,580	D337G	probably benign	Het
Tpsg1	T	C	17: 25,372,590	C55R	probably damaging	Het
Tram1l1	A	G	3: 124,322,262	K357R	probably benign	Het
Veph1	A	G	3: 66,263,895	I42T	probably damaging	Het
Vps13b	C	G	15: 35,709,310	S1801*	probably null	Het
Zcwpw1	G	A	5: 137,819,577		probably null	Het
Zfp266	G	A	9: 20,506,814		probably benign	Het
Zmym5	T	A	14: 56,794,461	R397*	probably null	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GTGACATGTAACTAAGCCTGTG -3'
(R):5'- AGCTTGGCTGAACTCACAG -3'

Sequencing Primer
(F):5'- ACATGTAACTAAGCCTGTGTTATTTC -3'
(R):5'- GAGACCCTGAACTCAGTTTTCCAG -3'

Posted On

2020-08-27