Incidental Mutation 'R8174:Ddx60'
ID643834
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R8174 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 62017250 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect probably null
Transcript: ENSMUST00000070631
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000093485
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik T G 1: 85,099,540 S102R probably damaging Het
Akap13 A G 7: 75,728,869 N2090S possibly damaging Het
Asxl3 T C 18: 22,517,743 S930P probably benign Het
Cachd1 T A 4: 100,966,269 I506N probably damaging Het
Calm1 G T 12: 100,205,708 V140L probably benign Het
Cdsn A T 17: 35,555,632 K353* probably null Het
Cldn11 T C 3: 31,154,061 V125A probably benign Het
Dlg2 A G 7: 91,940,040 I216V probably benign Het
Dnah5 A G 15: 28,311,133 probably null Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Erap1 A T 13: 74,646,564 Y114F probably benign Het
Fam179b G T 12: 64,982,691 D963Y possibly damaging Het
Gm14443 G A 2: 175,169,675 P326L probably damaging Het
Gm2042 T A 12: 87,960,158 L415Q probably damaging Het
Gm8797 T C 3: 5,751,034 I44T probably benign Het
Matn2 C A 15: 34,422,409 F547L probably benign Het
Mpc2 T A 1: 165,480,889 probably null Het
Olfr1445 A G 19: 12,883,904 T8A probably benign Het
Olfr77 A C 9: 19,920,724 T172P probably damaging Het
Pcnx4 T A 12: 72,556,913 L536Q probably damaging Het
Phlpp2 G A 8: 109,868,689 R24H unknown Het
Pkmyt1 A T 17: 23,733,839 D123V probably damaging Het
Polg A T 7: 79,456,718 M668K probably benign Het
Ppp1r12a G T 10: 108,271,737 A974S probably benign Het
Ppp2r3a T C 9: 101,213,302 probably benign Het
Rabl3 T C 16: 37,556,863 Y61H probably damaging Het
Rap2a T A 14: 120,478,857 I44N probably damaging Het
Rev3l T C 10: 39,859,115 V2779A probably damaging Het
Rnf43 G T 11: 87,731,231 R259L probably benign Het
Rspry1 T A 8: 94,649,822 L448Q probably damaging Het
Slc43a2 T G 11: 75,543,367 probably null Het
Slc6a5 A G 7: 49,948,309 I640M probably benign Het
Srrm2 C T 17: 23,815,323 P314S unknown Het
Strn4 C T 7: 16,828,808 R291C probably damaging Het
Syt4 T A 18: 31,444,177 R41S probably benign Het
Tfb1m T C 17: 3,519,580 D337G probably benign Het
Tpsg1 T C 17: 25,372,590 C55R probably damaging Het
Tram1l1 A G 3: 124,322,262 K357R probably benign Het
Veph1 A G 3: 66,263,895 I42T probably damaging Het
Vps13b C G 15: 35,709,310 S1801* probably null Het
Zcwpw1 G A 5: 137,819,577 probably null Het
Zfp266 G A 9: 20,506,814 probably benign Het
Zmym5 T A 14: 56,794,461 R397* probably null Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGACATGTAACTAAGCCTGTG -3'
(R):5'- AGCTTGGCTGAACTCACAG -3'

Sequencing Primer
(F):5'- ACATGTAACTAAGCCTGTGTTATTTC -3'
(R):5'- GAGACCCTGAACTCAGTTTTCCAG -3'
Posted On2020-08-27