Incidental Mutation 'R8174:Phlpp2'
ID 643835
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission 067599-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R8174 (G1)
Quality Score 51.0072
Status Validated
Chromosome 8
Chromosomal Location 109868542-109944671 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 109868689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 24 (R24H)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000093157] [ENSMUST00000179104] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect probably benign
Transcript: ENSMUST00000034175
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093157
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179104
Predicted Effect unknown
Transcript: ENSMUST00000179721
AA Change: R24H
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: R24H

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik T G 1: 85,099,540 (GRCm38) S102R probably damaging Het
Akap13 A G 7: 75,728,869 (GRCm38) N2090S possibly damaging Het
Asxl3 T C 18: 22,517,743 (GRCm38) S930P probably benign Het
Cachd1 T A 4: 100,966,269 (GRCm38) I506N probably damaging Het
Calm1 G T 12: 100,205,708 (GRCm38) V140L probably benign Het
Cdsn A T 17: 35,555,632 (GRCm38) K353* probably null Het
Cldn11 T C 3: 31,154,061 (GRCm38) V125A probably benign Het
Ddx60 G A 8: 62,017,250 (GRCm38) probably null Het
Dlg2 A G 7: 91,940,040 (GRCm38) I216V probably benign Het
Dnah5 A G 15: 28,311,133 (GRCm38) probably null Het
Dnajc28 G A 16: 91,616,907 (GRCm38) R150* probably null Het
Erap1 A T 13: 74,646,564 (GRCm38) Y114F probably benign Het
Gm14443 G A 2: 175,169,675 (GRCm38) P326L probably damaging Het
Gm2042 T A 12: 87,960,158 (GRCm38) L415Q probably damaging Het
Gm8797 T C 3: 5,751,034 (GRCm38) I44T probably benign Het
Matn2 C A 15: 34,422,409 (GRCm38) F547L probably benign Het
Mpc2 T A 1: 165,480,889 (GRCm38) probably null Het
Olfr1445 A G 19: 12,883,904 (GRCm38) T8A probably benign Het
Olfr77 A C 9: 19,920,724 (GRCm38) T172P probably damaging Het
Pcnx4 T A 12: 72,556,913 (GRCm38) L536Q probably damaging Het
Pkmyt1 A T 17: 23,733,839 (GRCm38) D123V probably damaging Het
Polg A T 7: 79,456,718 (GRCm38) M668K probably benign Het
Ppp1r12a G T 10: 108,271,737 (GRCm38) A974S probably benign Het
Ppp2r3a T C 9: 101,213,302 (GRCm38) probably benign Het
Rabl3 T C 16: 37,556,863 (GRCm38) Y61H probably damaging Het
Rap2a T A 14: 120,478,857 (GRCm38) I44N probably damaging Het
Rev3l T C 10: 39,859,115 (GRCm38) V2779A probably damaging Het
Rnf43 G T 11: 87,731,231 (GRCm38) R259L probably benign Het
Rspry1 T A 8: 94,649,822 (GRCm38) L448Q probably damaging Het
Slc43a2 T G 11: 75,543,367 (GRCm38) probably null Het
Slc6a5 A G 7: 49,948,309 (GRCm38) I640M probably benign Het
Srrm2 C T 17: 23,815,323 (GRCm38) P314S unknown Het
Strn4 C T 7: 16,828,808 (GRCm38) R291C probably damaging Het
Syt4 T A 18: 31,444,177 (GRCm38) R41S probably benign Het
Tfb1m T C 17: 3,519,580 (GRCm38) D337G probably benign Het
Togaram1 G T 12: 64,982,691 (GRCm38) D963Y possibly damaging Het
Tpsg1 T C 17: 25,372,590 (GRCm38) C55R probably damaging Het
Tram1l1 A G 3: 124,322,262 (GRCm38) K357R probably benign Het
Veph1 A G 3: 66,263,895 (GRCm38) I42T probably damaging Het
Vps13b C G 15: 35,709,310 (GRCm38) S1801* probably null Het
Zcwpw1 G A 5: 137,819,577 (GRCm38) probably null Het
Zfp266 G A 9: 20,506,814 (GRCm38) probably benign Het
Zmym5 T A 14: 56,794,461 (GRCm38) R397* probably null Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109,925,790 (GRCm38) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109,937,097 (GRCm38) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109,934,065 (GRCm38) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109,939,859 (GRCm38) missense probably benign
IGL02105:Phlpp2 APN 8 109,904,408 (GRCm38) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109,920,099 (GRCm38) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109,939,873 (GRCm38) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109,913,618 (GRCm38) missense probably benign
IGL03356:Phlpp2 APN 8 109,935,617 (GRCm38) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109,940,835 (GRCm38) missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109,907,513 (GRCm38) missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109,907,513 (GRCm38) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109,907,513 (GRCm38) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109,939,935 (GRCm38) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109,928,463 (GRCm38) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109,895,506 (GRCm38) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109,876,971 (GRCm38) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109,933,211 (GRCm38) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109,895,587 (GRCm38) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109,937,106 (GRCm38) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109,937,106 (GRCm38) missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109,877,030 (GRCm38) nonsense probably null
R1417:Phlpp2 UTSW 8 109,940,681 (GRCm38) nonsense probably null
R1602:Phlpp2 UTSW 8 109,934,023 (GRCm38) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109,933,955 (GRCm38) splice site probably benign
R1815:Phlpp2 UTSW 8 109,940,223 (GRCm38) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109,907,600 (GRCm38) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109,928,492 (GRCm38) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109,928,492 (GRCm38) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109,928,492 (GRCm38) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109,940,002 (GRCm38) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109,907,613 (GRCm38) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109,876,883 (GRCm38) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109,940,820 (GRCm38) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109,940,420 (GRCm38) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109,877,010 (GRCm38) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109,940,082 (GRCm38) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109,913,619 (GRCm38) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109,925,829 (GRCm38) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109,934,035 (GRCm38) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109,904,344 (GRCm38) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109,928,573 (GRCm38) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109,934,685 (GRCm38) missense probably benign
R6470:Phlpp2 UTSW 8 109,937,194 (GRCm38) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109,928,565 (GRCm38) missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 109,876,854 (GRCm38) missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 109,939,953 (GRCm38) missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 109,940,188 (GRCm38) missense probably benign
R7312:Phlpp2 UTSW 8 109,940,153 (GRCm38) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 109,928,646 (GRCm38) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 109,925,842 (GRCm38) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 109,895,557 (GRCm38) missense probably benign 0.00
R8242:Phlpp2 UTSW 8 109,940,202 (GRCm38) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 109,913,570 (GRCm38) missense probably benign
R8688:Phlpp2 UTSW 8 109,904,380 (GRCm38) missense probably damaging 1.00
R8843:Phlpp2 UTSW 8 109,925,799 (GRCm38) missense probably benign 0.18
R9154:Phlpp2 UTSW 8 109,939,958 (GRCm38) missense possibly damaging 0.82
R9556:Phlpp2 UTSW 8 109,940,126 (GRCm38) missense probably benign
R9737:Phlpp2 UTSW 8 109,937,082 (GRCm38) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 109,935,546 (GRCm38) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 109,934,023 (GRCm38) nonsense probably null
X0018:Phlpp2 UTSW 8 109,912,369 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTACCAAATTGCTCTCCCTG -3'
(R):5'- TGATGTCTTCAGGTGTCCGC -3'

Sequencing Primer
(F):5'- TGACGACTACGCAGGTCCAG -3'
(R):5'- TTCAGGTGTCCGCCGAGTC -3'
Posted On 2020-08-27