Incidental Mutation 'R8144:Acy1'
ID643840
Institutional Source Beutler Lab
Gene Symbol Acy1
Ensembl Gene ENSMUSG00000023262
Gene Nameaminoacylase 1
Synonyms1110014J22Rik, Acy-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8144 (G1)
Quality Score115.008
Status Validated
Chromosome9
Chromosomal Location106432981-106438319 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 106436120 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024031] [ENSMUST00000048685] [ENSMUST00000059802] [ENSMUST00000098994] [ENSMUST00000150576] [ENSMUST00000171678] [ENSMUST00000171925] [ENSMUST00000185334] [ENSMUST00000187001] [ENSMUST00000187983] [ENSMUST00000190798] [ENSMUST00000190803] [ENSMUST00000190900] [ENSMUST00000190972] [ENSMUST00000213448] [ENSMUST00000214067] [ENSMUST00000214275] [ENSMUST00000215395] [ENSMUST00000215506] [ENSMUST00000216400] [ENSMUST00000217081]
Predicted Effect probably null
Transcript: ENSMUST00000024031
SMART Domains Protein: ENSMUSP00000024031
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M28 61 239 8.6e-8 PFAM
Pfam:Peptidase_M20 76 397 1.8e-38 PFAM
Pfam:M20_dimer 188 302 1.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048685
SMART Domains Protein: ENSMUSP00000047322
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059802
SMART Domains Protein: ENSMUSP00000080203
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 1.4e-30 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098994
SMART Domains Protein: ENSMUSP00000096592
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 2.6e-27 PFAM
low complexity region 126 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150576
SMART Domains Protein: ENSMUSP00000117834
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 9.8e-28 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171678
SMART Domains Protein: ENSMUSP00000126101
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171925
SMART Domains Protein: ENSMUSP00000126916
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Abhydrolase_5 73 245 7.9e-17 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185334
SMART Domains Protein: ENSMUSP00000140345
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187001
SMART Domains Protein: ENSMUSP00000140042
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1imja_ 51 110 1e-10 SMART
PDB:1IMJ|A 58 110 6e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187983
SMART Domains Protein: ENSMUSP00000140901
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Abhydrolase_5 73 203 5.4e-12 PFAM
Pfam:Abhydrolase_6 74 197 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190798
SMART Domains Protein: ENSMUSP00000141096
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 1.7e-8 PFAM
Pfam:Abhydrolase_5 73 157 1.2e-8 PFAM
Pfam:Abhydrolase_6 74 157 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190803
Predicted Effect probably benign
Transcript: ENSMUST00000190900
SMART Domains Protein: ENSMUSP00000140582
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
PDB:1Q7L|C 1 50 9e-23 PDB
Predicted Effect probably null
Transcript: ENSMUST00000190972
SMART Domains Protein: ENSMUSP00000139953
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M20 76 216 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213448
Predicted Effect probably benign
Transcript: ENSMUST00000214067
Predicted Effect probably null
Transcript: ENSMUST00000214275
Predicted Effect probably null
Transcript: ENSMUST00000215395
Predicted Effect probably benign
Transcript: ENSMUST00000215506
Predicted Effect probably benign
Transcript: ENSMUST00000216400
Predicted Effect probably benign
Transcript: ENSMUST00000217081
Predicted Effect probably benign
Transcript: ENSMUST00000217531
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 98.0%
  • 20x: 90.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,259,105 probably benign Het
3110002H16Rik A T 18: 12,185,647 probably null Het
4932415D10Rik A T 10: 82,294,599 L859* probably null Het
A2ml1 T C 6: 128,569,999 D389G possibly damaging Het
Adcy2 G A 13: 68,734,635 Q328* probably null Het
Arhgef40 T A 14: 51,998,175 V1171E probably damaging Het
Arrb1 G A 7: 99,598,452 probably null Het
Atxn1l G A 8: 109,732,601 A343V probably benign Het
C3 A T 17: 57,226,276 V109E probably damaging Het
Clptm1 A T 7: 19,633,902 V595E possibly damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Dhrs3 T C 4: 144,919,904 S175P probably damaging Het
Eif2b1 A T 5: 124,573,145 M187K probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Evc2 T C 5: 37,380,567 L533P probably damaging Het
Fam221b T G 4: 43,665,465 Q331P probably damaging Het
Fam221b G T 4: 43,665,466 Q331K probably benign Het
Golga3 T C 5: 110,185,879 V127A probably damaging Het
Itsn1 C T 16: 91,912,005 P1719L unknown Het
Kdelc1 A G 1: 44,110,806 Y408H probably damaging Het
Lars T G 18: 42,218,526 H871P probably damaging Het
Mamdc4 A T 2: 25,567,007 V590E probably damaging Het
Mdga2 A G 12: 66,655,263 I457T probably damaging Het
Morc2a T C 11: 3,684,039 V717A probably benign Het
Olfr406 C A 11: 74,269,558 H56Q probably damaging Het
Olfr926 A T 9: 38,877,366 L63F probably damaging Het
Pank4 A T 4: 154,970,080 Q170L probably benign Het
Pde4dip G T 3: 97,715,426 A1489D probably damaging Het
Pde8b A T 13: 95,222,770 I15N probably damaging Het
Pex16 A C 2: 92,375,640 E26A probably damaging Het
Polq C T 16: 37,029,484 P367S probably benign Het
Polr1a T A 6: 71,950,616 V817E probably benign Het
Pthlh T C 6: 147,257,165 D99G probably damaging Het
Rasgrp4 A T 7: 29,149,117 S556C probably damaging Het
Rhobtb1 G T 10: 69,289,558 V653L possibly damaging Het
Rin2 G A 2: 145,822,305 R33Q probably benign Het
Sh3rf2 C T 18: 42,141,059 T430I probably benign Het
Slc14a2 A G 18: 78,184,544 probably null Het
Slc39a8 C T 3: 135,884,643 Q366* probably null Het
Tagln3 G T 16: 45,724,191 A39D probably benign Het
Tfdp1 T A 8: 13,373,015 C307S probably benign Het
Tlr11 T C 14: 50,362,488 S644P probably damaging Het
Tnpo3 T C 6: 29,558,762 D723G probably benign Het
Xpo5 A G 17: 46,208,219 N195D probably benign Het
Zfp11 T C 5: 129,656,630 Y589C possibly damaging Het
Zfp712 T C 13: 67,041,108 T452A probably benign Het
Other mutations in Acy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Acy1 APN 9 106436807 unclassified probably benign
IGL03029:Acy1 APN 9 106435115 missense probably damaging 0.98
IGL03304:Acy1 APN 9 106435466 critical splice donor site probably null
R0691:Acy1 UTSW 9 106435871 splice site probably null
R2152:Acy1 UTSW 9 106435617 missense probably damaging 1.00
R3882:Acy1 UTSW 9 106435509 missense possibly damaging 0.75
R4019:Acy1 UTSW 9 106436779 missense possibly damaging 0.94
R4421:Acy1 UTSW 9 106435713 splice site probably null
R4700:Acy1 UTSW 9 106433583 missense probably benign 0.00
R4931:Acy1 UTSW 9 106433191 missense probably damaging 1.00
R4934:Acy1 UTSW 9 106435122 missense probably null 1.00
R5030:Acy1 UTSW 9 106433397 missense probably benign 0.31
R5482:Acy1 UTSW 9 106434639 intron probably benign
R5748:Acy1 UTSW 9 106436727 missense probably damaging 1.00
R6932:Acy1 UTSW 9 106437627 critical splice donor site probably null
R7468:Acy1 UTSW 9 106437722 start codon destroyed probably null 0.64
R7768:Acy1 UTSW 9 106433618 missense possibly damaging 0.90
R8226:Acy1 UTSW 9 106437658 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCAGACTCCAGAAAACTCCCTG -3'
(R):5'- GACAGCAGGAGCCAAATTGC -3'

Sequencing Primer
(F):5'- AGAAAACTCCCTGCGCCTTTTC -3'
(R):5'- CAGGTAGCTGGGGTTTCTAGCC -3'
Posted On2020-08-28