Incidental Mutation 'R8160:Oasl2'
ID643842
Institutional Source Beutler Lab
Gene Symbol Oasl2
Ensembl Gene ENSMUSG00000029561
Gene Name2'-5' oligoadenylate synthetase-like 2
SynonymsMmu-OASL, M1204
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114896936-114912234 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 114901286 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031542] [ENSMUST00000124716] [ENSMUST00000146072] [ENSMUST00000150361]
Predicted Effect silent
Transcript: ENSMUST00000031542
SMART Domains Protein: ENSMUSP00000031542
Gene: ENSMUSG00000029561

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Pfam:OAS1_C 169 351 8.4e-77 PFAM
SCOP:d1euvb_ 355 427 4e-4 SMART
Blast:UBQ 355 430 9e-30 BLAST
UBQ 435 506 8.88e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124716
SMART Domains Protein: ENSMUSP00000115070
Gene: ENSMUSG00000029561

DomainStartEndE-ValueType
Pfam:OAS1_C 1 131 1.2e-48 PFAM
SCOP:d1euvb_ 135 207 6e-5 SMART
Blast:UBQ 135 210 9e-32 BLAST
Blast:UBQ 215 240 5e-10 BLAST
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000146072
SMART Domains Protein: ENSMUSP00000117795
Gene: ENSMUSG00000029561

DomainStartEndE-ValueType
PDB:1PX5|B 6 101 4e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150361
SMART Domains Protein: ENSMUSP00000119042
Gene: ENSMUSG00000029561

DomainStartEndE-ValueType
PDB:1PX5|B 6 140 3e-13 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415F15Rik T C 11: 11,487,734 S246P unknown Het
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Other mutations in Oasl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Oasl2 APN 5 114897806 missense probably damaging 1.00
IGL02649:Oasl2 APN 5 114897692 missense probably damaging 1.00
IGL02810:Oasl2 APN 5 114897791 missense probably damaging 1.00
IGL03153:Oasl2 APN 5 114901332 missense probably benign 0.02
R0179:Oasl2 UTSW 5 114910912 missense probably benign
R1318:Oasl2 UTSW 5 114901381 missense probably benign 0.01
R1831:Oasl2 UTSW 5 114901306 missense probably benign 0.00
R1941:Oasl2 UTSW 5 114911362 utr 3 prime probably benign
R2068:Oasl2 UTSW 5 114911237 missense probably benign 0.01
R2104:Oasl2 UTSW 5 114911002 nonsense probably null
R2170:Oasl2 UTSW 5 114906800 missense probably damaging 0.99
R2437:Oasl2 UTSW 5 114911296 missense probably benign
R2882:Oasl2 UTSW 5 114911023 missense probably damaging 1.00
R3960:Oasl2 UTSW 5 114905037 missense probably benign 0.03
R3962:Oasl2 UTSW 5 114897747 missense probably benign 0.01
R4609:Oasl2 UTSW 5 114899796 missense possibly damaging 0.47
R4761:Oasl2 UTSW 5 114899775 missense probably benign 0.00
R5242:Oasl2 UTSW 5 114905061 missense possibly damaging 0.92
R5691:Oasl2 UTSW 5 114899767 missense possibly damaging 0.93
R6594:Oasl2 UTSW 5 114906775 missense probably benign 0.30
R7053:Oasl2 UTSW 5 114911230 missense possibly damaging 0.82
R7062:Oasl2 UTSW 5 114911091 nonsense probably null
R7688:Oasl2 UTSW 5 114897848 missense probably benign 0.01
R7753:Oasl2 UTSW 5 114905057 missense probably benign
R8026:Oasl2 UTSW 5 114902268 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCATGAGCCTGAAGGTCTACC -3'
(R):5'- GCTACAGATGCGTGCGTACC -3'

Sequencing Primer
(F):5'- TGTAATGAGATCTGACGCCC -3'
(R):5'- AGATGCGTGCGTACCCTCTG -3'
Posted On2020-08-28