Incidental Mutation 'R8109:Gmcl1'
ID643865
Institutional Source Beutler Lab
Gene Symbol Gmcl1
Ensembl Gene ENSMUSG00000001157
Gene Namegerm cell-less, spermatogenesis associated 1
SynonymsGcl, mglc-1, 2810049L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R8109 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location86691768-86733383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86721426 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 163 (A163E)
Ref Sequence ENSEMBL: ENSMUSP00000001185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001185] [ENSMUST00000113679]
Predicted Effect probably damaging
Transcript: ENSMUST00000001185
AA Change: A163E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001185
Gene: ENSMUSG00000001157
AA Change: A163E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
BTB 106 206 3.76e-11 SMART
BACK 211 298 3.6e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113679
AA Change: A163E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109309
Gene: ENSMUSG00000001157
AA Change: A163E

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
Pfam:BTB 96 195 5.5e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired nuclear membrane integrity in liver, endocrine pancreas, and testis. Mutant males show reduced fertility with decreased chromatin condensation and morphologically abnormal sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,652 V130A probably benign Het
Adamts12 A C 15: 11,331,791 K1465T probably benign Het
Adamtsl1 T C 4: 86,248,069 V223A Het
Adamtsl3 T A 7: 82,602,279 I1494N possibly damaging Het
Ank3 T C 10: 69,990,318 Y1606H Het
Arhgap32 A G 9: 32,181,854 I168V probably benign Het
Atxn7l2 G A 3: 108,203,301 R675C probably damaging Het
Bst2 A T 8: 71,537,346 W28R probably damaging Het
Cadps T A 14: 12,488,975 T861S probably benign Het
Ceacam11 A G 7: 17,975,318 Y147C probably benign Het
Clasp2 T A 9: 113,911,520 N1187K probably damaging Het
Dcaf7 T C 11: 106,046,778 W76R probably damaging Het
Ephb1 G A 9: 102,041,023 T429I probably damaging Het
Flg A T 3: 93,290,427 Q21L unknown Het
Flrt2 T C 12: 95,780,559 V557A probably benign Het
Gdpgp1 T C 7: 80,238,833 V204A probably damaging Het
Gm498 C T 7: 143,897,466 probably null Het
Gm5136 A G 10: 108,699,659 M145T probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Jph2 T C 2: 163,339,286 K653E probably benign Het
Kmt2c T C 5: 25,281,384 S4724G probably damaging Het
Llgl2 T C 11: 115,850,793 V583A possibly damaging Het
Met T C 6: 17,562,237 V1199A probably damaging Het
Mmp25 A G 17: 23,644,794 W21R probably benign Het
Nsun4 A T 4: 116,051,843 C507S probably benign Het
Olfr348 T A 2: 36,786,606 M27K probably benign Het
Pard6g T C 18: 80,117,443 V257A possibly damaging Het
Pcdh1 A G 18: 38,198,996 V457A probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Plpp6 T A 19: 28,964,491 M164K possibly damaging Het
Rhobtb2 C A 14: 69,800,631 R60L probably damaging Het
Rsph10b A C 5: 143,985,530 I845L probably benign Het
Sdf4 C T 4: 156,009,838 A325V probably damaging Het
Slc4a3 A G 1: 75,551,804 D481G possibly damaging Het
Smo A G 6: 29,755,523 Y398C probably damaging Het
Sox18 A G 2: 181,671,500 Y8H possibly damaging Het
Sycp1 A T 3: 102,851,602 S780T probably benign Het
Tdg T A 10: 82,644,519 V239E probably damaging Het
Tenm2 T C 11: 36,008,310 T2675A probably benign Het
Thrap3 C A 4: 126,186,480 R31L unknown Het
Tinagl1 T A 4: 130,169,330 I149F probably damaging Het
Tnc A G 4: 64,008,763 V842A probably benign Het
Tpm3-rs7 A G 14: 113,315,340 D222G probably benign Het
Ube4a T C 9: 44,935,483 I773V probably benign Het
Vmn1r229 T C 17: 20,815,006 V171A probably benign Het
Zc3hav1 T C 6: 38,329,179 E646G probably damaging Het
Zfp341 A T 2: 154,627,900 M168L probably benign Het
Zfp874a A C 13: 67,449,444 D13E possibly damaging Het
Other mutations in Gmcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Gmcl1 APN 6 86707457 missense possibly damaging 0.52
IGL03354:Gmcl1 APN 6 86726158 missense probably damaging 1.00
PIT4453001:Gmcl1 UTSW 6 86704538 missense probably benign 0.09
R0149:Gmcl1 UTSW 6 86732909 critical splice donor site probably null
R1398:Gmcl1 UTSW 6 86714262 splice site probably benign
R1869:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R1871:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R2851:Gmcl1 UTSW 6 86726177 missense probably damaging 0.99
R4584:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4585:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4664:Gmcl1 UTSW 6 86732998 missense probably benign 0.30
R4851:Gmcl1 UTSW 6 86704556 missense possibly damaging 0.64
R4957:Gmcl1 UTSW 6 86710521 missense probably damaging 1.00
R5326:Gmcl1 UTSW 6 86726145 missense possibly damaging 0.96
R5482:Gmcl1 UTSW 6 86718073 missense probably damaging 1.00
R5496:Gmcl1 UTSW 6 86697525 missense probably damaging 0.97
R5817:Gmcl1 UTSW 6 86714248 missense probably damaging 1.00
R5854:Gmcl1 UTSW 6 86714259 splice site silent
R5891:Gmcl1 UTSW 6 86707443 missense probably damaging 1.00
R5895:Gmcl1 UTSW 6 86711614 missense probably benign 0.03
R6012:Gmcl1 UTSW 6 86721412 missense probably damaging 1.00
R6257:Gmcl1 UTSW 6 86700641 missense possibly damaging 0.82
R7693:Gmcl1 UTSW 6 86714257 missense probably benign 0.10
R7698:Gmcl1 UTSW 6 86707415 missense probably benign 0.00
R7999:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8049:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8093:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8110:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8111:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8154:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8157:Gmcl1 UTSW 6 86721426 missense probably damaging 1.00
R8208:Gmcl1 UTSW 6 86721399 missense probably damaging 0.99
R8250:Gmcl1 UTSW 6 86721402 missense possibly damaging 0.72
R8509:Gmcl1 UTSW 6 86722607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATCCAGTTCACACAGTG -3'
(R):5'- TGGCAGAATCCTTTCCAACAAG -3'

Sequencing Primer
(F):5'- GTTCACACAGTGATCAAAGACCTTC -3'
(R):5'- GCAGAATCCTTTCCAACAAGCAATG -3'
Posted On2020-09-02