Incidental Mutation 'R8109:Adamtsl3'
ID643868
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8109 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82602279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1494 (I1494N)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173287
AA Change: I1494N

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: I1494N

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: I568N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (47/48)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,652 V130A probably benign Het
Adamts12 A C 15: 11,331,791 K1465T probably benign Het
Adamtsl1 T C 4: 86,248,069 V223A Het
Ank3 T C 10: 69,990,318 Y1606H Het
Arhgap32 A G 9: 32,181,854 I168V probably benign Het
Atxn7l2 G A 3: 108,203,301 R675C probably damaging Het
Bst2 A T 8: 71,537,346 W28R probably damaging Het
Cadps T A 14: 12,488,975 T861S probably benign Het
Ceacam11 A G 7: 17,975,318 Y147C probably benign Het
Clasp2 T A 9: 113,911,520 N1187K probably damaging Het
Dcaf7 T C 11: 106,046,778 W76R probably damaging Het
Ephb1 G A 9: 102,041,023 T429I probably damaging Het
Flg A T 3: 93,290,427 Q21L unknown Het
Flrt2 T C 12: 95,780,559 V557A probably benign Het
Gdpgp1 T C 7: 80,238,833 V204A probably damaging Het
Gm498 C T 7: 143,897,466 probably null Het
Gm5136 A G 10: 108,699,659 M145T probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Jph2 T C 2: 163,339,286 K653E probably benign Het
Kmt2c T C 5: 25,281,384 S4724G probably damaging Het
Llgl2 T C 11: 115,850,793 V583A possibly damaging Het
Met T C 6: 17,562,237 V1199A probably damaging Het
Mmp25 A G 17: 23,644,794 W21R probably benign Het
Nsun4 A T 4: 116,051,843 C507S probably benign Het
Olfr348 T A 2: 36,786,606 M27K probably benign Het
Pard6g T C 18: 80,117,443 V257A possibly damaging Het
Pcdh1 A G 18: 38,198,996 V457A probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Plpp6 T A 19: 28,964,491 M164K possibly damaging Het
Rhobtb2 C A 14: 69,800,631 R60L probably damaging Het
Rsph10b A C 5: 143,985,530 I845L probably benign Het
Sdf4 C T 4: 156,009,838 A325V probably damaging Het
Slc4a3 A G 1: 75,551,804 D481G possibly damaging Het
Smo A G 6: 29,755,523 Y398C probably damaging Het
Sox18 A G 2: 181,671,500 Y8H possibly damaging Het
Sycp1 A T 3: 102,851,602 S780T probably benign Het
Tdg T A 10: 82,644,519 V239E probably damaging Het
Tenm2 T C 11: 36,008,310 T2675A probably benign Het
Thrap3 C A 4: 126,186,480 R31L unknown Het
Tinagl1 T A 4: 130,169,330 I149F probably damaging Het
Tnc A G 4: 64,008,763 V842A probably benign Het
Tpm3-rs7 A G 14: 113,315,340 D222G probably benign Het
Ube4a T C 9: 44,935,483 I773V probably benign Het
Vmn1r229 T C 17: 20,815,006 V171A probably benign Het
Zc3hav1 T C 6: 38,329,179 E646G probably damaging Het
Zfp341 A T 2: 154,627,900 M168L probably benign Het
Zfp874a A C 13: 67,449,444 D13E possibly damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 splice site probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7617:Adamtsl3 UTSW 7 82556846 splice site probably null
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
R8125:Adamtsl3 UTSW 7 82450333 splice site probably null
R8211:Adamtsl3 UTSW 7 82523163 missense probably damaging 1.00
R8348:Adamtsl3 UTSW 7 82603799 missense possibly damaging 0.89
R8360:Adamtsl3 UTSW 7 82547979 missense probably damaging 1.00
R8448:Adamtsl3 UTSW 7 82603799 missense possibly damaging 0.89
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCTGCAGAGCACTTTTGG -3'
(R):5'- CTGTTAAACAGTCCAAATTGCTGTC -3'

Sequencing Primer
(F):5'- TGCAGAGCACTTTTGGGAACC -3'
(R):5'- GCATGATGCATTCAGAGGCC -3'
Posted On2020-09-02