Incidental Mutation 'R8109:Bst2'
ID 643869
Institutional Source Beutler Lab
Gene Symbol Bst2
Ensembl Gene ENSMUSG00000046718
Gene Name bone marrow stromal cell antigen 2
Synonyms Bst-2, C87040, 2310015I10Rik, GREG
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8109 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71534255-71537456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71537346 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 28 (W28R)
Ref Sequence ENSEMBL: ENSMUSP00000051921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051672]
AlphaFold Q8R2Q8
PDB Structure Crystal Structure of Mouse BST-2/Tetherin Ectodomain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000051672
AA Change: W28R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051921
Gene: ENSMUSG00000046718
AA Change: W28R

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Pfam:BST2 54 144 1.9e-37 PFAM
low complexity region 148 171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to the LP-BM5 strain of Mo-MLV (murine AIDS). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,652 V130A probably benign Het
Adamts12 A C 15: 11,331,791 K1465T probably benign Het
Adamtsl1 T C 4: 86,248,069 V223A Het
Adamtsl3 T A 7: 82,602,279 I1494N possibly damaging Het
Ank3 T C 10: 69,990,318 Y1606H Het
Arhgap32 A G 9: 32,181,854 I168V probably benign Het
Atxn7l2 G A 3: 108,203,301 R675C probably damaging Het
Cadps T A 14: 12,488,975 T861S probably benign Het
Ceacam11 A G 7: 17,975,318 Y147C probably benign Het
Clasp2 T A 9: 113,911,520 N1187K probably damaging Het
Dcaf7 T C 11: 106,046,778 W76R probably damaging Het
Ephb1 G A 9: 102,041,023 T429I probably damaging Het
Flg A T 3: 93,290,427 Q21L unknown Het
Flrt2 T C 12: 95,780,559 V557A probably benign Het
Gdpgp1 T C 7: 80,238,833 V204A probably damaging Het
Gm498 C T 7: 143,897,466 probably null Het
Gm5136 A G 10: 108,699,659 M145T probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Jph2 T C 2: 163,339,286 K653E probably benign Het
Kmt2c T C 5: 25,281,384 S4724G probably damaging Het
Llgl2 T C 11: 115,850,793 V583A possibly damaging Het
Met T C 6: 17,562,237 V1199A probably damaging Het
Mmp25 A G 17: 23,644,794 W21R probably benign Het
Nsun4 A T 4: 116,051,843 C507S probably benign Het
Olfr348 T A 2: 36,786,606 M27K probably benign Het
Pard6g T C 18: 80,117,443 V257A possibly damaging Het
Pcdh1 A G 18: 38,198,996 V457A probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Plpp6 T A 19: 28,964,491 M164K possibly damaging Het
Rhobtb2 C A 14: 69,800,631 R60L probably damaging Het
Rsph10b A C 5: 143,985,530 I845L probably benign Het
Sdf4 C T 4: 156,009,838 A325V probably damaging Het
Slc4a3 A G 1: 75,551,804 D481G possibly damaging Het
Smo A G 6: 29,755,523 Y398C probably damaging Het
Sox18 A G 2: 181,671,500 Y8H possibly damaging Het
Sycp1 A T 3: 102,851,602 S780T probably benign Het
Tdg T A 10: 82,644,519 V239E probably damaging Het
Tenm2 T C 11: 36,008,310 T2675A probably benign Het
Thrap3 C A 4: 126,186,480 R31L unknown Het
Tinagl1 T A 4: 130,169,330 I149F probably damaging Het
Tnc A G 4: 64,008,763 V842A probably benign Het
Tpm3-rs7 A G 14: 113,315,340 D222G probably benign Het
Ube4a T C 9: 44,935,483 I773V probably benign Het
Vmn1r229 T C 17: 20,815,006 V171A probably benign Het
Zc3hav1 T C 6: 38,329,179 E646G probably damaging Het
Zfp341 A T 2: 154,627,900 M168L probably benign Het
Zfp874a A C 13: 67,449,444 D13E possibly damaging Het
Other mutations in Bst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Bst2 APN 8 71537186 missense probably damaging 0.97
R0158:Bst2 UTSW 8 71537217 missense possibly damaging 0.95
R6383:Bst2 UTSW 8 71537288 missense possibly damaging 0.95
R6868:Bst2 UTSW 8 71534760 missense unknown
R7109:Bst2 UTSW 8 71537282 missense possibly damaging 0.93
R7322:Bst2 UTSW 8 71537207 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGTTGCAGGAGTTTGCC -3'
(R):5'- AATTGCGTTGGACTCCTGAAG -3'

Sequencing Primer
(F):5'- TGCAGCAGACTGTCCTGG -3'
(R):5'- CCTGAAGTTGCTATTTGCTAGAAGC -3'
Posted On 2020-09-02