Incidental Mutation 'R8109:Aars'
ID643870
Institutional Source Beutler Lab
Gene Symbol Aars
Ensembl Gene ENSMUSG00000031960
Gene Namealanyl-tRNA synthetase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8109 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111033144-111057664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111040652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 130 (V130A)
Ref Sequence ENSEMBL: ENSMUSP00000034441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034441] [ENSMUST00000125268]
Predicted Effect probably benign
Transcript: ENSMUST00000034441
AA Change: V130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: V130A

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 9 597 9.2e-228 PFAM
tRNA_SAD 694 753 5.97e-18 SMART
Pfam:DHHA1 885 957 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125268
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A C 15: 11,331,791 K1465T probably benign Het
Adamtsl1 T C 4: 86,248,069 V223A Het
Adamtsl3 T A 7: 82,602,279 I1494N possibly damaging Het
Ank3 T C 10: 69,990,318 Y1606H Het
Arhgap32 A G 9: 32,181,854 I168V probably benign Het
Atxn7l2 G A 3: 108,203,301 R675C probably damaging Het
Bst2 A T 8: 71,537,346 W28R probably damaging Het
Cadps T A 14: 12,488,975 T861S probably benign Het
Ceacam11 A G 7: 17,975,318 Y147C probably benign Het
Clasp2 T A 9: 113,911,520 N1187K probably damaging Het
Dcaf7 T C 11: 106,046,778 W76R probably damaging Het
Ephb1 G A 9: 102,041,023 T429I probably damaging Het
Flg A T 3: 93,290,427 Q21L unknown Het
Flrt2 T C 12: 95,780,559 V557A probably benign Het
Gdpgp1 T C 7: 80,238,833 V204A probably damaging Het
Gm498 C T 7: 143,897,466 probably null Het
Gm5136 A G 10: 108,699,659 M145T probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Jph2 T C 2: 163,339,286 K653E probably benign Het
Kmt2c T C 5: 25,281,384 S4724G probably damaging Het
Llgl2 T C 11: 115,850,793 V583A possibly damaging Het
Met T C 6: 17,562,237 V1199A probably damaging Het
Mmp25 A G 17: 23,644,794 W21R probably benign Het
Nsun4 A T 4: 116,051,843 C507S probably benign Het
Olfr348 T A 2: 36,786,606 M27K probably benign Het
Pard6g T C 18: 80,117,443 V257A possibly damaging Het
Pcdh1 A G 18: 38,198,996 V457A probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Plpp6 T A 19: 28,964,491 M164K possibly damaging Het
Rhobtb2 C A 14: 69,800,631 R60L probably damaging Het
Rsph10b A C 5: 143,985,530 I845L probably benign Het
Sdf4 C T 4: 156,009,838 A325V probably damaging Het
Slc4a3 A G 1: 75,551,804 D481G possibly damaging Het
Smo A G 6: 29,755,523 Y398C probably damaging Het
Sox18 A G 2: 181,671,500 Y8H possibly damaging Het
Sycp1 A T 3: 102,851,602 S780T probably benign Het
Tdg T A 10: 82,644,519 V239E probably damaging Het
Tenm2 T C 11: 36,008,310 T2675A probably benign Het
Thrap3 C A 4: 126,186,480 R31L unknown Het
Tinagl1 T A 4: 130,169,330 I149F probably damaging Het
Tnc A G 4: 64,008,763 V842A probably benign Het
Tpm3-rs7 A G 14: 113,315,340 D222G probably benign Het
Ube4a T C 9: 44,935,483 I773V probably benign Het
Vmn1r229 T C 17: 20,815,006 V171A probably benign Het
Zc3hav1 T C 6: 38,329,179 E646G probably damaging Het
Zfp341 A T 2: 154,627,900 M168L probably benign Het
Zfp874a A C 13: 67,449,444 D13E possibly damaging Het
Other mutations in Aars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Aars APN 8 111047972 missense possibly damaging 0.86
IGL00731:Aars APN 8 111044869 splice site probably benign
IGL00826:Aars APN 8 111040300 missense probably damaging 1.00
IGL01521:Aars APN 8 111043787 missense possibly damaging 0.85
IGL01885:Aars APN 8 111047943 missense possibly damaging 0.89
IGL01920:Aars APN 8 111043246 missense probably damaging 1.00
IGL01934:Aars APN 8 111048018 missense probably damaging 0.98
IGL02013:Aars APN 8 111047066 missense probably damaging 0.99
IGL02489:Aars APN 8 111054215 unclassified probably benign
IGL02683:Aars APN 8 111052531 unclassified probably benign
IGL03084:Aars APN 8 111041629 missense probably damaging 1.00
H8786:Aars UTSW 8 111045555 missense probably benign
R0037:Aars UTSW 8 111043259 missense possibly damaging 0.77
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0577:Aars UTSW 8 111043278 missense probably benign 0.10
R1183:Aars UTSW 8 111041574 nonsense probably null
R1642:Aars UTSW 8 111043250 missense possibly damaging 0.77
R1829:Aars UTSW 8 111042706 missense probably damaging 1.00
R1857:Aars UTSW 8 111040157 missense probably damaging 0.99
R2190:Aars UTSW 8 111040153 missense probably damaging 1.00
R2303:Aars UTSW 8 111052502 missense possibly damaging 0.84
R3918:Aars UTSW 8 111040142 missense probably damaging 1.00
R4001:Aars UTSW 8 111041602 missense probably damaging 1.00
R4434:Aars UTSW 8 111054621 missense probably null 0.74
R4909:Aars UTSW 8 111055083 missense probably damaging 1.00
R4970:Aars UTSW 8 111043679 missense probably benign 0.00
R5639:Aars UTSW 8 111043234 missense probably benign 0.01
R5991:Aars UTSW 8 111050400 missense probably damaging 1.00
R6403:Aars UTSW 8 111042249 missense possibly damaging 0.87
R6521:Aars UTSW 8 111043336 missense probably benign 0.01
R6956:Aars UTSW 8 111055130 missense probably benign 0.38
R7378:Aars UTSW 8 111042342 missense probably damaging 1.00
R7625:Aars UTSW 8 111046955 missense probably damaging 0.99
R7745:Aars UTSW 8 111041657 missense probably damaging 1.00
R7792:Aars UTSW 8 111043264 missense possibly damaging 0.75
R7860:Aars UTSW 8 111049861 missense probably benign 0.16
R8197:Aars UTSW 8 111053996 missense probably benign 0.44
R8322:Aars UTSW 8 111045528 missense possibly damaging 0.93
R8343:Aars UTSW 8 111040729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTCCCTAGGAAACATGTATC -3'
(R):5'- GGGTTACACTCTTATCTGCACC -3'

Sequencing Primer
(F):5'- CTCCCTAGGAAACATGTATCATTTG -3'
(R):5'- ACACTCTTATCTGCACCACCCC -3'
Posted On2020-09-02