Incidental Mutation 'R8109:Llgl2'
ID643880
Institutional Source Beutler Lab
Gene Symbol Llgl2
Ensembl Gene ENSMUSG00000020782
Gene NameLLGL2 scribble cell polarity complex component
Synonyms9130006H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R8109 (G1)
Quality Score210.009
Status Validated
Chromosome11
Chromosomal Location115824049-115855780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115850793 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 583 (V583A)
Ref Sequence ENSEMBL: ENSMUSP00000099321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000177736]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103032
AA Change: V583A

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: V583A

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128826
Predicted Effect probably benign
Transcript: ENSMUST00000177736
AA Change: V583A

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: V583A

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,652 V130A probably benign Het
Adamts12 A C 15: 11,331,791 K1465T probably benign Het
Adamtsl1 T C 4: 86,248,069 V223A Het
Adamtsl3 T A 7: 82,602,279 I1494N possibly damaging Het
Ank3 T C 10: 69,990,318 Y1606H Het
Arhgap32 A G 9: 32,181,854 I168V probably benign Het
Atxn7l2 G A 3: 108,203,301 R675C probably damaging Het
Bst2 A T 8: 71,537,346 W28R probably damaging Het
Cadps T A 14: 12,488,975 T861S probably benign Het
Ceacam11 A G 7: 17,975,318 Y147C probably benign Het
Clasp2 T A 9: 113,911,520 N1187K probably damaging Het
Dcaf7 T C 11: 106,046,778 W76R probably damaging Het
Ephb1 G A 9: 102,041,023 T429I probably damaging Het
Flg A T 3: 93,290,427 Q21L unknown Het
Flrt2 T C 12: 95,780,559 V557A probably benign Het
Gdpgp1 T C 7: 80,238,833 V204A probably damaging Het
Gm498 C T 7: 143,897,466 probably null Het
Gm5136 A G 10: 108,699,659 M145T probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Jph2 T C 2: 163,339,286 K653E probably benign Het
Kmt2c T C 5: 25,281,384 S4724G probably damaging Het
Met T C 6: 17,562,237 V1199A probably damaging Het
Mmp25 A G 17: 23,644,794 W21R probably benign Het
Nsun4 A T 4: 116,051,843 C507S probably benign Het
Olfr348 T A 2: 36,786,606 M27K probably benign Het
Pard6g T C 18: 80,117,443 V257A possibly damaging Het
Pcdh1 A G 18: 38,198,996 V457A probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Plpp6 T A 19: 28,964,491 M164K possibly damaging Het
Rhobtb2 C A 14: 69,800,631 R60L probably damaging Het
Rsph10b A C 5: 143,985,530 I845L probably benign Het
Sdf4 C T 4: 156,009,838 A325V probably damaging Het
Slc4a3 A G 1: 75,551,804 D481G possibly damaging Het
Smo A G 6: 29,755,523 Y398C probably damaging Het
Sox18 A G 2: 181,671,500 Y8H possibly damaging Het
Sycp1 A T 3: 102,851,602 S780T probably benign Het
Tdg T A 10: 82,644,519 V239E probably damaging Het
Tenm2 T C 11: 36,008,310 T2675A probably benign Het
Thrap3 C A 4: 126,186,480 R31L unknown Het
Tinagl1 T A 4: 130,169,330 I149F probably damaging Het
Tnc A G 4: 64,008,763 V842A probably benign Het
Tpm3-rs7 A G 14: 113,315,340 D222G probably benign Het
Ube4a T C 9: 44,935,483 I773V probably benign Het
Vmn1r229 T C 17: 20,815,006 V171A probably benign Het
Zc3hav1 T C 6: 38,329,179 E646G probably damaging Het
Zfp341 A T 2: 154,627,900 M168L probably benign Het
Zfp874a A C 13: 67,449,444 D13E possibly damaging Het
Other mutations in Llgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Llgl2 APN 11 115834884 missense probably benign 0.00
IGL01145:Llgl2 APN 11 115853805 missense probably benign
IGL01344:Llgl2 APN 11 115851193 missense probably benign 0.01
IGL01980:Llgl2 APN 11 115850025 missense probably damaging 1.00
IGL02220:Llgl2 APN 11 115845379 missense possibly damaging 0.64
IGL02341:Llgl2 APN 11 115851120 missense possibly damaging 0.70
IGL02399:Llgl2 APN 11 115844835 missense probably damaging 0.97
IGL02415:Llgl2 APN 11 115853285 missense probably damaging 0.98
IGL02632:Llgl2 APN 11 115844872 missense probably damaging 1.00
IGL02990:Llgl2 APN 11 115854333 missense probably benign 0.01
IGL03405:Llgl2 APN 11 115850842 missense probably benign 0.09
R0097:Llgl2 UTSW 11 115844497 nonsense probably null
R0166:Llgl2 UTSW 11 115844854 missense probably damaging 1.00
R0277:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0323:Llgl2 UTSW 11 115850720 missense probably damaging 1.00
R0345:Llgl2 UTSW 11 115849992 splice site probably benign
R0614:Llgl2 UTSW 11 115850267 missense probably damaging 1.00
R0980:Llgl2 UTSW 11 115850001 missense probably damaging 1.00
R1387:Llgl2 UTSW 11 115853132 missense probably damaging 0.99
R1456:Llgl2 UTSW 11 115845499 missense probably benign 0.00
R1541:Llgl2 UTSW 11 115853121 missense probably benign 0.00
R1832:Llgl2 UTSW 11 115851100 missense probably damaging 1.00
R1950:Llgl2 UTSW 11 115851066 missense probably damaging 0.96
R2991:Llgl2 UTSW 11 115851120 missense probably benign 0.05
R4018:Llgl2 UTSW 11 115847612 missense probably benign 0.31
R4582:Llgl2 UTSW 11 115850706 missense possibly damaging 0.89
R4729:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R4907:Llgl2 UTSW 11 115853974 nonsense probably null
R5000:Llgl2 UTSW 11 115844902 missense probably benign
R5016:Llgl2 UTSW 11 115853424 missense probably damaging 1.00
R5175:Llgl2 UTSW 11 115850721 missense probably damaging 1.00
R5857:Llgl2 UTSW 11 115850281 missense probably damaging 1.00
R6190:Llgl2 UTSW 11 115846986 missense probably benign 0.00
R6451:Llgl2 UTSW 11 115844941 missense probably damaging 0.99
R6804:Llgl2 UTSW 11 115843315 critical splice acceptor site probably null
R6909:Llgl2 UTSW 11 115850799 missense probably damaging 1.00
R7324:Llgl2 UTSW 11 115850730 missense possibly damaging 0.49
R7332:Llgl2 UTSW 11 115848299 missense probably damaging 0.98
R7715:Llgl2 UTSW 11 115849728 missense probably benign
R8038:Llgl2 UTSW 11 115851103 missense probably benign 0.17
R8069:Llgl2 UTSW 11 115853286 missense probably damaging 0.99
R8076:Llgl2 UTSW 11 115846929 missense possibly damaging 0.69
R8129:Llgl2 UTSW 11 115850911 splice site probably null
R8731:Llgl2 UTSW 11 115851190 missense probably benign 0.01
R8881:Llgl2 UTSW 11 115853040 missense probably benign 0.02
X0058:Llgl2 UTSW 11 115850637 missense probably damaging 0.99
Z1176:Llgl2 UTSW 11 115849554 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGCTGAGCTATCTGCCAC -3'
(R):5'- AGTGTGCACCTTGAGGAAG -3'

Sequencing Primer
(F):5'- GAGCTATCTGCCACCCCCAC -3'
(R):5'- GAATGTCGTGTCAGGCCATCAAC -3'
Posted On2020-09-02