Incidental Mutation 'R8323:Psme4'
ID 643930
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 067724-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8323 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30793532 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1211 (I1211N)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: I1211N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: I1211N

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,649,351 (GRCm39) F6S probably benign Het
Braf T C 6: 39,620,058 (GRCm39) T507A possibly damaging Het
Catsperb A C 12: 101,375,658 (GRCm39) H24P probably benign Het
Ccdc57 G T 11: 120,788,750 (GRCm39) Q366K possibly damaging Het
Cep295 G T 9: 15,249,529 (GRCm39) T462K possibly damaging Het
Cep295 T A 9: 15,264,357 (GRCm39) R96S probably damaging Het
Cfap206 C T 4: 34,719,647 (GRCm39) E256K probably benign Het
Cfap251 A G 5: 123,435,588 (GRCm39) N1016S probably benign Het
Cldn13 A G 5: 134,943,828 (GRCm39) V119A probably benign Het
Csmd1 G T 8: 17,266,751 (GRCm39) C58* probably null Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Dcbld2 T A 16: 58,283,473 (GRCm39) probably null Het
Dnah14 A G 1: 181,532,109 (GRCm39) I2299V probably benign Het
Dsp C T 13: 38,356,806 (GRCm39) H229Y possibly damaging Het
Fam193b A T 13: 55,702,223 (GRCm39) C51* probably null Het
Fbxw10 G A 11: 62,767,506 (GRCm39) V781I probably benign Het
Fdps G T 3: 89,002,696 (GRCm39) P151T possibly damaging Het
Galk2 C T 2: 125,708,298 (GRCm39) H16Y probably benign Het
Gm1110 A G 9: 26,813,719 (GRCm39) probably null Het
Gm3727 C T 14: 7,261,693 (GRCm38) V204I probably benign Het
Gtf2h3 A G 5: 124,720,534 (GRCm39) I13V probably benign Het
H2-T24 T A 17: 36,328,431 (GRCm39) probably null Het
Heatr5a C T 12: 52,002,289 (GRCm39) V216M probably benign Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Igfbp2 C T 1: 72,888,780 (GRCm39) P224S probably damaging Het
Igkv17-127 A G 6: 67,838,498 (GRCm39) I70V possibly damaging Het
Kif11 T A 19: 37,372,692 (GRCm39) F27I possibly damaging Het
Lcor T C 19: 41,572,036 (GRCm39) S264P probably benign Het
Lrrc28 G T 7: 67,245,455 (GRCm39) T137K unknown Het
Lyg1 T A 1: 37,989,018 (GRCm39) R67S probably damaging Het
Ms4a10 G A 19: 10,940,363 (GRCm39) Q255* probably null Het
Myo1h A G 5: 114,480,200 (GRCm39) R512G Het
Nmnat3 T C 9: 98,292,276 (GRCm39) Y174H probably damaging Het
Nrap T C 19: 56,378,255 (GRCm39) I19V probably benign Het
Nsf C A 11: 103,819,665 (GRCm39) V35L probably benign Het
Or1e30 A T 11: 73,677,766 (GRCm39) M1L probably damaging Het
Or2w6 T A 13: 21,843,302 (GRCm39) M64L possibly damaging Het
Osbpl9 A G 4: 108,965,119 (GRCm39) S116P probably benign Het
Pcdhb15 A C 18: 37,608,715 (GRCm39) E649A probably benign Het
Pcdhb8 T A 18: 37,488,476 (GRCm39) D51E probably benign Het
Plcl1 T A 1: 55,736,895 (GRCm39) D745E possibly damaging Het
Prss3 A G 6: 41,351,258 (GRCm39) L165P probably damaging Het
Rb1 A G 14: 73,503,023 (GRCm39) V416A probably benign Het
Rnf111 T A 9: 70,383,204 (GRCm39) Q243L probably benign Het
Sacm1l T C 9: 123,377,987 (GRCm39) V89A probably benign Het
Sardh C T 2: 27,125,576 (GRCm39) D313N probably damaging Het
Scin T C 12: 40,129,681 (GRCm39) I371V probably benign Het
Scn10a C A 9: 119,438,462 (GRCm39) L1801F possibly damaging Het
Sele G A 1: 163,879,207 (GRCm39) V281M possibly damaging Het
Slc17a1 C A 13: 24,071,982 (GRCm39) T400K probably damaging Het
Slc22a28 T A 19: 8,108,788 (GRCm39) D118V probably damaging Het
Slc2a10 T A 2: 165,356,671 (GRCm39) F110L probably benign Het
Slc51a A G 16: 32,295,197 (GRCm39) S294P probably damaging Het
Snapc4 T C 2: 26,254,711 (GRCm39) E1271G probably benign Het
Spata31 C A 13: 65,070,065 (GRCm39) Q738K possibly damaging Het
Spdya A G 17: 71,895,587 (GRCm39) D284G probably benign Het
Tdrd5 T C 1: 156,094,832 (GRCm39) D757G possibly damaging Het
Tmem104 T C 11: 115,134,199 (GRCm39) F245S probably damaging Het
Tmem170 A T 8: 112,603,153 (GRCm39) S39T probably benign Het
Trim24 G T 6: 37,892,233 (GRCm39) probably null Het
Uap1 A G 1: 169,978,635 (GRCm39) V302A probably damaging Het
Vmn2r96 A T 17: 18,803,023 (GRCm39) Y311F probably damaging Het
Wdhd1 A T 14: 47,512,252 (GRCm39) D46E possibly damaging Het
Zdbf2 G A 1: 63,342,073 (GRCm39) V151I possibly damaging Het
Zfp747l1 A T 7: 126,983,621 (GRCm39) C494S possibly damaging Het
Zfp943 A G 17: 22,211,763 (GRCm39) Q283R possibly damaging Het
Zfp944 A T 17: 22,558,235 (GRCm39) D337E probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTATAAAAGACAGCTTGTGTTGG -3'
(R):5'- AGCTGACTTTCGAATTCTGGACC -3'

Sequencing Primer
(F):5'- GGGACCTAATCTTTGAGAAACTCCTG -3'
(R):5'- GAATTCTGGACCTTTCTACCTGTG -3'
Posted On 2020-09-02