Incidental Mutation 'R8323:Psme4'
ID643930
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8323 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30843532 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1211 (I1211N)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: I1211N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: I1211N

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A T 7: 127,384,449 C494S possibly damaging Het
A3galt2 T C 4: 128,755,558 F6S probably benign Het
Braf T C 6: 39,643,124 T507A possibly damaging Het
Catsperb A C 12: 101,409,399 H24P probably benign Het
Ccdc57 G T 11: 120,897,924 Q366K possibly damaging Het
Cep295 G T 9: 15,338,233 T462K possibly damaging Het
Cep295 T A 9: 15,353,061 R96S probably damaging Het
Cfap206 C T 4: 34,719,647 E256K probably benign Het
Cldn13 A G 5: 134,914,974 V119A probably benign Het
Csmd1 G T 8: 17,216,735 C58* probably null Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Dcbld2 T A 16: 58,463,110 probably null Het
Dnah14 A G 1: 181,704,544 I2299V probably benign Het
Dsp C T 13: 38,172,830 H229Y possibly damaging Het
Fam193b A T 13: 55,554,410 C51* probably null Het
Fbxw10 G A 11: 62,876,680 V781I probably benign Het
Fdps G T 3: 89,095,389 P151T possibly damaging Het
Galk2 C T 2: 125,866,378 H16Y probably benign Het
Gm1110 A G 9: 26,902,423 probably null Het
Gm340 T C 19: 41,583,597 S264P probably benign Het
Gm3727 C T 14: 7,261,693 V204I probably benign Het
Gtf2h3 A G 5: 124,582,471 I13V probably benign Het
H2-T24 T A 17: 36,017,539 probably null Het
Heatr5a C T 12: 51,955,506 V216M probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Igfbp2 C T 1: 72,849,621 P224S probably damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Kif11 T A 19: 37,384,244 F27I possibly damaging Het
Lrrc28 G T 7: 67,595,707 T137K unknown Het
Lyg1 T A 1: 37,949,937 R67S probably damaging Het
Ms4a10 G A 19: 10,962,999 Q255* probably null Het
Myo1h A G 5: 114,342,139 R512G Het
Nmnat3 T C 9: 98,410,223 Y174H probably damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Nsf C A 11: 103,928,839 V35L probably benign Het
Olfr1361 T A 13: 21,659,132 M64L possibly damaging Het
Olfr390 A T 11: 73,786,940 M1L probably damaging Het
Osbpl9 A G 4: 109,107,922 S116P probably benign Het
Pcdhb15 A C 18: 37,475,662 E649A probably benign Het
Pcdhb8 T A 18: 37,355,423 D51E probably benign Het
Plcl1 T A 1: 55,697,736 D745E possibly damaging Het
Prss3 A G 6: 41,374,324 L165P probably damaging Het
Rb1 A G 14: 73,265,583 V416A probably benign Het
Rnf111 T A 9: 70,475,922 Q243L probably benign Het
Sacm1l T C 9: 123,548,922 V89A probably benign Het
Sardh C T 2: 27,235,564 D313N probably damaging Het
Scin T C 12: 40,079,682 I371V probably benign Het
Scn10a C A 9: 119,609,396 L1801F possibly damaging Het
Sele G A 1: 164,051,638 V281M possibly damaging Het
Slc17a1 C A 13: 23,887,999 T400K probably damaging Het
Slc22a28 T A 19: 8,131,424 D118V probably damaging Het
Slc2a10 T A 2: 165,514,751 F110L probably benign Het
Slc51a A G 16: 32,476,379 S294P probably damaging Het
Snapc4 T C 2: 26,364,699 E1271G probably benign Het
Spata31 C A 13: 64,922,251 Q738K possibly damaging Het
Spdya A G 17: 71,588,592 D284G probably benign Het
Tdrd5 T C 1: 156,267,262 D757G possibly damaging Het
Tmem104 T C 11: 115,243,373 F245S probably damaging Het
Tmem170 A T 8: 111,876,521 S39T probably benign Het
Trim24 G T 6: 37,915,298 probably null Het
Uap1 A G 1: 170,151,066 V302A probably damaging Het
Vmn2r96 A T 17: 18,582,761 Y311F probably damaging Het
Wdhd1 A T 14: 47,274,795 D46E possibly damaging Het
Wdr66 A G 5: 123,297,525 N1016S probably benign Het
Zdbf2 G A 1: 63,302,914 V151I possibly damaging Het
Zfp943 A G 17: 21,992,782 Q283R possibly damaging Het
Zfp944 A T 17: 22,339,254 D337E probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTATAAAAGACAGCTTGTGTTGG -3'
(R):5'- AGCTGACTTTCGAATTCTGGACC -3'

Sequencing Primer
(F):5'- GGGACCTAATCTTTGAGAAACTCCTG -3'
(R):5'- GAATTCTGGACCTTTCTACCTGTG -3'
Posted On2020-09-02