Incidental Mutation 'R8323:Tmem104'
ID643934
Institutional Source Beutler Lab
Gene Symbol Tmem104
Ensembl Gene ENSMUSG00000045980
Gene Nametransmembrane protein 104
SynonymsC630005D06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8323 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115187487-115247023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115243373 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 245 (F245S)
Ref Sequence ENSEMBL: ENSMUSP00000056805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061450] [ENSMUST00000100235]
Predicted Effect probably damaging
Transcript: ENSMUST00000061450
AA Change: F245S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056805
Gene: ENSMUSG00000045980
AA Change: F245S

DomainStartEndE-ValueType
Pfam:Aa_trans 13 77 3.4e-10 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 128 487 4.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100235
AA Change: F244S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097807
Gene: ENSMUSG00000045980
AA Change: F244S

DomainStartEndE-ValueType
Pfam:Aa_trans 13 81 5.5e-11 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 127 485 1.2e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A T 7: 127,384,449 C494S possibly damaging Het
A3galt2 T C 4: 128,755,558 F6S probably benign Het
Braf T C 6: 39,643,124 T507A possibly damaging Het
Catsperb A C 12: 101,409,399 H24P probably benign Het
Ccdc57 G T 11: 120,897,924 Q366K possibly damaging Het
Cep295 G T 9: 15,338,233 T462K possibly damaging Het
Cep295 T A 9: 15,353,061 R96S probably damaging Het
Cfap206 C T 4: 34,719,647 E256K probably benign Het
Cldn13 A G 5: 134,914,974 V119A probably benign Het
Csmd1 G T 8: 17,216,735 C58* probably null Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Dcbld2 T A 16: 58,463,110 probably null Het
Dnah14 A G 1: 181,704,544 I2299V probably benign Het
Dsp C T 13: 38,172,830 H229Y possibly damaging Het
Fam193b A T 13: 55,554,410 C51* probably null Het
Fbxw10 G A 11: 62,876,680 V781I probably benign Het
Fdps G T 3: 89,095,389 P151T possibly damaging Het
Galk2 C T 2: 125,866,378 H16Y probably benign Het
Gm1110 A G 9: 26,902,423 probably null Het
Gm340 T C 19: 41,583,597 S264P probably benign Het
Gm3727 C T 14: 7,261,693 V204I probably benign Het
Gtf2h3 A G 5: 124,582,471 I13V probably benign Het
H2-T24 T A 17: 36,017,539 probably null Het
Heatr5a C T 12: 51,955,506 V216M probably benign Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Igfbp2 C T 1: 72,849,621 P224S probably damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Kif11 T A 19: 37,384,244 F27I possibly damaging Het
Lrrc28 G T 7: 67,595,707 T137K unknown Het
Lyg1 T A 1: 37,949,937 R67S probably damaging Het
Ms4a10 G A 19: 10,962,999 Q255* probably null Het
Myo1h A G 5: 114,342,139 R512G Het
Nmnat3 T C 9: 98,410,223 Y174H probably damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Nsf C A 11: 103,928,839 V35L probably benign Het
Olfr1361 T A 13: 21,659,132 M64L possibly damaging Het
Olfr390 A T 11: 73,786,940 M1L probably damaging Het
Osbpl9 A G 4: 109,107,922 S116P probably benign Het
Pcdhb15 A C 18: 37,475,662 E649A probably benign Het
Pcdhb8 T A 18: 37,355,423 D51E probably benign Het
Plcl1 T A 1: 55,697,736 D745E possibly damaging Het
Prss3 A G 6: 41,374,324 L165P probably damaging Het
Psme4 T A 11: 30,843,532 I1211N probably damaging Het
Rb1 A G 14: 73,265,583 V416A probably benign Het
Rnf111 T A 9: 70,475,922 Q243L probably benign Het
Sacm1l T C 9: 123,548,922 V89A probably benign Het
Sardh C T 2: 27,235,564 D313N probably damaging Het
Scin T C 12: 40,079,682 I371V probably benign Het
Scn10a C A 9: 119,609,396 L1801F possibly damaging Het
Sele G A 1: 164,051,638 V281M possibly damaging Het
Slc17a1 C A 13: 23,887,999 T400K probably damaging Het
Slc22a28 T A 19: 8,131,424 D118V probably damaging Het
Slc2a10 T A 2: 165,514,751 F110L probably benign Het
Slc51a A G 16: 32,476,379 S294P probably damaging Het
Snapc4 T C 2: 26,364,699 E1271G probably benign Het
Spata31 C A 13: 64,922,251 Q738K possibly damaging Het
Spdya A G 17: 71,588,592 D284G probably benign Het
Tdrd5 T C 1: 156,267,262 D757G possibly damaging Het
Tmem170 A T 8: 111,876,521 S39T probably benign Het
Trim24 G T 6: 37,915,298 probably null Het
Uap1 A G 1: 170,151,066 V302A probably damaging Het
Vmn2r96 A T 17: 18,582,761 Y311F probably damaging Het
Wdhd1 A T 14: 47,274,795 D46E possibly damaging Het
Wdr66 A G 5: 123,297,525 N1016S probably benign Het
Zdbf2 G A 1: 63,302,914 V151I possibly damaging Het
Zfp943 A G 17: 21,992,782 Q283R possibly damaging Het
Zfp944 A T 17: 22,339,254 D337E probably benign Het
Other mutations in Tmem104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tmem104 APN 11 115243937 missense probably damaging 1.00
IGL02948:Tmem104 APN 11 115197296 missense probably damaging 1.00
IGL03010:Tmem104 APN 11 115243534 missense probably benign 0.01
R0107:Tmem104 UTSW 11 115202180 missense probably damaging 1.00
R0399:Tmem104 UTSW 11 115201308 splice site probably benign
R0534:Tmem104 UTSW 11 115200828 missense probably damaging 1.00
R2034:Tmem104 UTSW 11 115243547 missense probably benign 0.42
R2037:Tmem104 UTSW 11 115201395 missense possibly damaging 0.95
R4095:Tmem104 UTSW 11 115243923 nonsense probably null
R4640:Tmem104 UTSW 11 115243724 missense probably damaging 1.00
R4981:Tmem104 UTSW 11 115205136 missense probably damaging 1.00
R5011:Tmem104 UTSW 11 115243486 missense probably damaging 1.00
R5086:Tmem104 UTSW 11 115201401 missense probably damaging 0.98
R5522:Tmem104 UTSW 11 115188323 critical splice donor site probably null
R5602:Tmem104 UTSW 11 115205124 missense probably damaging 1.00
R6025:Tmem104 UTSW 11 115205523 nonsense probably null
R6247:Tmem104 UTSW 11 115243993 missense probably benign
R6522:Tmem104 UTSW 11 115243753 missense probably damaging 1.00
R7962:Tmem104 UTSW 11 115243481 missense probably damaging 0.99
R7980:Tmem104 UTSW 11 115243754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAGGATGTGTTTATCAAAGAC -3'
(R):5'- TAGAAGGCCAGGATCAGTGC -3'

Sequencing Primer
(F):5'- GACATTCATAGGCTCAGCAGC -3'
(R):5'- TCAGTGCGTAGTCCAGGAAC -3'
Posted On2020-09-02