Mutagenetix > Incidental Mutations

Incidental Mutation 'R8323:Heatr5a'

643937

Institutional Source

Beutler Lab

Gene Symbol

Heatr5a

Ensembl Gene

ENSMUSG00000035181

Gene Name

HEAT repeat containing 5A

Synonyms

D930036F22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R8323 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

51875871-51971321 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 51955506 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 216 (V216M)

Ref Sequence

ENSEMBL: ENSMUSP00000043115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040583]

Predicted Effect

probably benign
Transcript: ENSMUST00000040583
AA Change: V216M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: V216M

Domain	Start	End	E-Value	Type
low complexity region	56	67	N/A	INTRINSIC
SCOP:d1qbkb_	112	658	6e-13	SMART
low complexity region	1063	1078	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1110	1120	N/A	INTRINSIC
low complexity region	1122	1135	N/A	INTRINSIC
low complexity region	1496	1507	N/A	INTRINSIC
low complexity region	1722	1735	N/A	INTRINSIC
low complexity region	1925	1936	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	A	T	7: 127,384,449	C494S	possibly damaging	Het
A3galt2	T	C	4: 128,755,558	F6S	probably benign	Het
Braf	T	C	6: 39,643,124	T507A	possibly damaging	Het
Catsperb	A	C	12: 101,409,399	H24P	probably benign	Het
Ccdc57	G	T	11: 120,897,924	Q366K	possibly damaging	Het
Cep295	G	T	9: 15,338,233	T462K	possibly damaging	Het
Cep295	T	A	9: 15,353,061	R96S	probably damaging	Het
Cfap206	C	T	4: 34,719,647	E256K	probably benign	Het
Cldn13	A	G	5: 134,914,974	V119A	probably benign	Het
Csmd1	G	T	8: 17,216,735	C58*	probably null	Het
Csmd3	T	C	15: 47,698,151	Y1343C		Het
Dcbld2	T	A	16: 58,463,110		probably null	Het
Dnah14	A	G	1: 181,704,544	I2299V	probably benign	Het
Dsp	C	T	13: 38,172,830	H229Y	possibly damaging	Het
Fam193b	A	T	13: 55,554,410	C51*	probably null	Het
Fbxw10	G	A	11: 62,876,680	V781I	probably benign	Het
Fdps	G	T	3: 89,095,389	P151T	possibly damaging	Het
Galk2	C	T	2: 125,866,378	H16Y	probably benign	Het
Gm1110	A	G	9: 26,902,423		probably null	Het
Gm340	T	C	19: 41,583,597	S264P	probably benign	Het
Gm3727	C	T	14: 7,261,693	V204I	probably benign	Het
Gtf2h3	A	G	5: 124,582,471	I13V	probably benign	Het
H2-T24	T	A	17: 36,017,539		probably null	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Igfbp2	C	T	1: 72,849,621	P224S	probably damaging	Het
Igkv17-127	A	G	6: 67,861,514	I70V	possibly damaging	Het
Kif11	T	A	19: 37,384,244	F27I	possibly damaging	Het
Lrrc28	G	T	7: 67,595,707	T137K	unknown	Het
Lyg1	T	A	1: 37,949,937	R67S	probably damaging	Het
Ms4a10	G	A	19: 10,962,999	Q255*	probably null	Het
Myo1h	A	G	5: 114,342,139	R512G		Het
Nmnat3	T	C	9: 98,410,223	Y174H	probably damaging	Het
Nrap	T	C	19: 56,389,823	I19V	probably benign	Het
Nsf	C	A	11: 103,928,839	V35L	probably benign	Het
Olfr1361	T	A	13: 21,659,132	M64L	possibly damaging	Het
Olfr390	A	T	11: 73,786,940	M1L	probably damaging	Het
Osbpl9	A	G	4: 109,107,922	S116P	probably benign	Het
Pcdhb15	A	C	18: 37,475,662	E649A	probably benign	Het
Pcdhb8	T	A	18: 37,355,423	D51E	probably benign	Het
Plcl1	T	A	1: 55,697,736	D745E	possibly damaging	Het
Prss3	A	G	6: 41,374,324	L165P	probably damaging	Het
Psme4	T	A	11: 30,843,532	I1211N	probably damaging	Het
Rb1	A	G	14: 73,265,583	V416A	probably benign	Het
Rnf111	T	A	9: 70,475,922	Q243L	probably benign	Het
Sacm1l	T	C	9: 123,548,922	V89A	probably benign	Het
Sardh	C	T	2: 27,235,564	D313N	probably damaging	Het
Scin	T	C	12: 40,079,682	I371V	probably benign	Het
Scn10a	C	A	9: 119,609,396	L1801F	possibly damaging	Het
Sele	G	A	1: 164,051,638	V281M	possibly damaging	Het
Slc17a1	C	A	13: 23,887,999	T400K	probably damaging	Het
Slc22a28	T	A	19: 8,131,424	D118V	probably damaging	Het
Slc2a10	T	A	2: 165,514,751	F110L	probably benign	Het
Slc51a	A	G	16: 32,476,379	S294P	probably damaging	Het
Snapc4	T	C	2: 26,364,699	E1271G	probably benign	Het
Spata31	C	A	13: 64,922,251	Q738K	possibly damaging	Het
Spdya	A	G	17: 71,588,592	D284G	probably benign	Het
Tdrd5	T	C	1: 156,267,262	D757G	possibly damaging	Het
Tmem104	T	C	11: 115,243,373	F245S	probably damaging	Het
Tmem170	A	T	8: 111,876,521	S39T	probably benign	Het
Trim24	G	T	6: 37,915,298		probably null	Het
Uap1	A	G	1: 170,151,066	V302A	probably damaging	Het
Vmn2r96	A	T	17: 18,582,761	Y311F	probably damaging	Het
Wdhd1	A	T	14: 47,274,795	D46E	possibly damaging	Het
Wdr66	A	G	5: 123,297,525	N1016S	probably benign	Het
Zdbf2	G	A	1: 63,302,914	V151I	possibly damaging	Het
Zfp943	A	G	17: 21,992,782	Q283R	possibly damaging	Het
Zfp944	A	T	17: 22,339,254	D337E	probably benign	Het

Other mutations in Heatr5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Heatr5a	APN	12	51888901	missense	probably damaging	0.99
IGL01397:Heatr5a	APN	12	51894369	missense	possibly damaging	0.89
IGL01481:Heatr5a	APN	12	51955425	missense	probably damaging	1.00
IGL01684:Heatr5a	APN	12	51955511	missense	probably benign	0.36
IGL01766:Heatr5a	APN	12	51889664	missense	probably benign	0.15
IGL01799:Heatr5a	APN	12	51897835	missense	probably benign	0.17
IGL02007:Heatr5a	APN	12	51916158	missense	probably damaging	1.00
IGL02093:Heatr5a	APN	12	51916075	missense	possibly damaging	0.68
IGL02205:Heatr5a	APN	12	51877337	missense	probably damaging	1.00
IGL02450:Heatr5a	APN	12	51945430	missense	probably benign	0.02
IGL02565:Heatr5a	APN	12	51951099	missense	possibly damaging	0.54
IGL02707:Heatr5a	APN	12	51921366	missense	probably benign	0.01
IGL02735:Heatr5a	APN	12	51915021	missense	probably damaging	0.99
IGL03160:Heatr5a	APN	12	51884496	splice site	probably benign
F5770:Heatr5a	UTSW	12	51881278	splice site	probably benign
R0034:Heatr5a	UTSW	12	51925172	missense	probably damaging	1.00
R0127:Heatr5a	UTSW	12	51925405	missense	probably benign
R0184:Heatr5a	UTSW	12	51909969	missense	probably benign	0.00
R0362:Heatr5a	UTSW	12	51888861	missense	probably damaging	1.00
R0567:Heatr5a	UTSW	12	51910089	missense	probably damaging	1.00
R0591:Heatr5a	UTSW	12	51910101	splice site	probably benign
R0736:Heatr5a	UTSW	12	51896561	critical splice donor site	probably null
R1532:Heatr5a	UTSW	12	51952518	missense	probably damaging	0.99
R1914:Heatr5a	UTSW	12	51905467	missense	probably damaging	1.00
R1956:Heatr5a	UTSW	12	51945419	critical splice donor site	probably null
R1978:Heatr5a	UTSW	12	51939658	missense	possibly damaging	0.77
R2044:Heatr5a	UTSW	12	51955403	missense	probably benign	0.19
R2263:Heatr5a	UTSW	12	51916150	missense	probably damaging	0.97
R2265:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2267:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2268:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2269:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2842:Heatr5a	UTSW	12	51955478	missense	probably null	1.00
R2842:Heatr5a	UTSW	12	51955477	splice site	probably null
R3033:Heatr5a	UTSW	12	51951038	nonsense	probably null
R4303:Heatr5a	UTSW	12	51956225	missense	probably benign	0.01
R4675:Heatr5a	UTSW	12	51877347	missense	probably benign	0.17
R4718:Heatr5a	UTSW	12	51916163	missense	possibly damaging	0.95
R4807:Heatr5a	UTSW	12	51877520	missense	probably damaging	1.00
R5114:Heatr5a	UTSW	12	51956237	nonsense	probably null
R5229:Heatr5a	UTSW	12	51947978	missense	probably benign	0.33
R5411:Heatr5a	UTSW	12	51888243	missense	probably damaging	1.00
R5548:Heatr5a	UTSW	12	51958951	nonsense	probably null
R5603:Heatr5a	UTSW	12	51877575	missense	probably benign	0.26
R5631:Heatr5a	UTSW	12	51955527	missense	probably benign	0.22
R5742:Heatr5a	UTSW	12	51955552	nonsense	probably null
R5969:Heatr5a	UTSW	12	51959040	missense	probably benign
R6020:Heatr5a	UTSW	12	51884327	missense	probably benign	0.01
R6234:Heatr5a	UTSW	12	51877454	missense	possibly damaging	0.69
R6352:Heatr5a	UTSW	12	51951166	missense	possibly damaging	0.88
R6798:Heatr5a	UTSW	12	51881265	missense	probably benign	0.01
R6815:Heatr5a	UTSW	12	51955508	missense	possibly damaging	0.89
R7059:Heatr5a	UTSW	12	51888234	missense	probably damaging	0.98
R7143:Heatr5a	UTSW	12	51961468	missense	probably benign	0.09
R7178:Heatr5a	UTSW	12	51925142	missense	probably damaging	0.99
R7291:Heatr5a	UTSW	12	51925339	missense	probably damaging	0.97
R7454:Heatr5a	UTSW	12	51961543	missense	probably benign	0.20
R7511:Heatr5a	UTSW	12	51879434	missense	possibly damaging	0.94
R7636:Heatr5a	UTSW	12	51888196	missense	probably damaging	1.00
R7636:Heatr5a	UTSW	12	51952558	missense	probably damaging	1.00
R7665:Heatr5a	UTSW	12	51961530	missense	probably damaging	1.00
R8088:Heatr5a	UTSW	12	51947996	missense	possibly damaging	0.85
R8205:Heatr5a	UTSW	12	51959009	missense	probably benign	0.05
R8212:Heatr5a	UTSW	12	51899229	missense	probably benign	0.00
R8213:Heatr5a	UTSW	12	51891443	missense	probably damaging	0.96
R8326:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8339:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8395:Heatr5a	UTSW	12	51916178	missense
R8410:Heatr5a	UTSW	12	51938120	missense	probably benign	0.01
R8676:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8834:Heatr5a	UTSW	12	51909956	critical splice donor site	probably null
R8916:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
V7732:Heatr5a	UTSW	12	51905324	missense	possibly damaging	0.65
Z1088:Heatr5a	UTSW	12	51891404	missense	probably damaging	1.00
Z1088:Heatr5a	UTSW	12	51951076	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- GCTGCAATGTTACAACACAGGAG -3'
(R):5'- TAGAAGGCGGTTGTCCTCAC -3'

Sequencing Primer
(F):5'- GATTAAGTCAAGGAAGTCACTCTG -3'
(R):5'- GTTCTTGGTTATTCCCGTCAACATAG -3'

Posted On

2020-09-02