Incidental Mutation 'R8323:Heatr5a'
ID 643937
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene Name HEAT repeat containing 5A
Synonyms D930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock # R8323 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 51875871-51971321 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 51955506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 216 (V216M)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
AlphaFold Q5PRF0
Predicted Effect probably benign
Transcript: ENSMUST00000040583
AA Change: V216M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: V216M

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A T 7: 127,384,449 C494S possibly damaging Het
A3galt2 T C 4: 128,755,558 F6S probably benign Het
Braf T C 6: 39,643,124 T507A possibly damaging Het
Catsperb A C 12: 101,409,399 H24P probably benign Het
Ccdc57 G T 11: 120,897,924 Q366K possibly damaging Het
Cep295 G T 9: 15,338,233 T462K possibly damaging Het
Cep295 T A 9: 15,353,061 R96S probably damaging Het
Cfap206 C T 4: 34,719,647 E256K probably benign Het
Cldn13 A G 5: 134,914,974 V119A probably benign Het
Csmd1 G T 8: 17,216,735 C58* probably null Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Dcbld2 T A 16: 58,463,110 probably null Het
Dnah14 A G 1: 181,704,544 I2299V probably benign Het
Dsp C T 13: 38,172,830 H229Y possibly damaging Het
Fam193b A T 13: 55,554,410 C51* probably null Het
Fbxw10 G A 11: 62,876,680 V781I probably benign Het
Fdps G T 3: 89,095,389 P151T possibly damaging Het
Galk2 C T 2: 125,866,378 H16Y probably benign Het
Gm1110 A G 9: 26,902,423 probably null Het
Gm340 T C 19: 41,583,597 S264P probably benign Het
Gm3727 C T 14: 7,261,693 V204I probably benign Het
Gtf2h3 A G 5: 124,582,471 I13V probably benign Het
H2-T24 T A 17: 36,017,539 probably null Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Igfbp2 C T 1: 72,849,621 P224S probably damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Kif11 T A 19: 37,384,244 F27I possibly damaging Het
Lrrc28 G T 7: 67,595,707 T137K unknown Het
Lyg1 T A 1: 37,949,937 R67S probably damaging Het
Ms4a10 G A 19: 10,962,999 Q255* probably null Het
Myo1h A G 5: 114,342,139 R512G Het
Nmnat3 T C 9: 98,410,223 Y174H probably damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Nsf C A 11: 103,928,839 V35L probably benign Het
Olfr1361 T A 13: 21,659,132 M64L possibly damaging Het
Olfr390 A T 11: 73,786,940 M1L probably damaging Het
Osbpl9 A G 4: 109,107,922 S116P probably benign Het
Pcdhb15 A C 18: 37,475,662 E649A probably benign Het
Pcdhb8 T A 18: 37,355,423 D51E probably benign Het
Plcl1 T A 1: 55,697,736 D745E possibly damaging Het
Prss3 A G 6: 41,374,324 L165P probably damaging Het
Psme4 T A 11: 30,843,532 I1211N probably damaging Het
Rb1 A G 14: 73,265,583 V416A probably benign Het
Rnf111 T A 9: 70,475,922 Q243L probably benign Het
Sacm1l T C 9: 123,548,922 V89A probably benign Het
Sardh C T 2: 27,235,564 D313N probably damaging Het
Scin T C 12: 40,079,682 I371V probably benign Het
Scn10a C A 9: 119,609,396 L1801F possibly damaging Het
Sele G A 1: 164,051,638 V281M possibly damaging Het
Slc17a1 C A 13: 23,887,999 T400K probably damaging Het
Slc22a28 T A 19: 8,131,424 D118V probably damaging Het
Slc2a10 T A 2: 165,514,751 F110L probably benign Het
Slc51a A G 16: 32,476,379 S294P probably damaging Het
Snapc4 T C 2: 26,364,699 E1271G probably benign Het
Spata31 C A 13: 64,922,251 Q738K possibly damaging Het
Spdya A G 17: 71,588,592 D284G probably benign Het
Tdrd5 T C 1: 156,267,262 D757G possibly damaging Het
Tmem104 T C 11: 115,243,373 F245S probably damaging Het
Tmem170 A T 8: 111,876,521 S39T probably benign Het
Trim24 G T 6: 37,915,298 probably null Het
Uap1 A G 1: 170,151,066 V302A probably damaging Het
Vmn2r96 A T 17: 18,582,761 Y311F probably damaging Het
Wdhd1 A T 14: 47,274,795 D46E possibly damaging Het
Wdr66 A G 5: 123,297,525 N1016S probably benign Het
Zdbf2 G A 1: 63,302,914 V151I possibly damaging Het
Zfp943 A G 17: 21,992,782 Q283R possibly damaging Het
Zfp944 A T 17: 22,339,254 D337E probably benign Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8212:Heatr5a UTSW 12 51899229 missense probably benign 0.00
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
R8676:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9057:Heatr5a UTSW 12 51939637 missense probably damaging 1.00
R9248:Heatr5a UTSW 12 51916243 missense
R9287:Heatr5a UTSW 12 51920477 missense probably damaging 0.97
R9332:Heatr5a UTSW 12 51899285 missense probably benign 0.33
R9454:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9515:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9654:Heatr5a UTSW 12 51958995 missense probably damaging 1.00
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GCTGCAATGTTACAACACAGGAG -3'
(R):5'- TAGAAGGCGGTTGTCCTCAC -3'

Sequencing Primer
(F):5'- GATTAAGTCAAGGAAGTCACTCTG -3'
(R):5'- GTTCTTGGTTATTCCCGTCAACATAG -3'
Posted On 2020-09-02